Rna Extraction Cdna Synthesis And Real Time Pcr For...

RNA extraction, cDNA synthesis and real-time PCR for Smad3 gene Total RNA was extracted from frozen kidney tissues after processing using Qiagen RNeasy Total RNA isolation kit (Qiagen, Hiden, Germany) according to the protocol provided by the manufacturer, followed by synthesis of the first strand using SuperScript  ® III First-Strand Synthesis System for RT-PCR kit (Life Technologies) according to the manufacturer’s instructions. PCR reactions were performed using Power SYBR Green PCR Master Mix (Life Technologies) following the manufacturer’s instructions. Smad3 mRNA transcripts were quantified, relative to the housekeeping gene, glyceraldehyde-3-phosphatedehydrogenase (GAPDH) which was used as an internal control. Sequence specific primers were designed by Primer3 software: (http://bioinfo.ut.ee/primer3/) as follows: rat Smad3 forward primer (5 - AGGGCTTTGAGGCTGTCTACC-3 ) and reverse primer (5 - ACCCGATCCCTTTACTCCCA -3 ) (GenBank Accession No. NM_016769.4); rat GAPDH forward primer (5†²-GGTGAAGTTCGGAGTCAACGGA-3†²) and reverse primer (5†²-GAGGGATCTCGCTCCTGGAAGA-3†²) (GenBank Accession No. NM_017008). The final results were automatically calculated from the cross-point values of the target and the reference gene by Rotor-Gene Q 6plex and its specific software (Qiagen, Valencia, CA, USA). Statistical analysis Statistical analysis was conducted as mean and standard deviation using Statistical Package for Social Sciences (SPSS), version 16.0 for Windows (SPSS, Chicago, IL).Show MoreRelatedEnvironmental Pollutants, Drug And Ionizing Radiation Causes Inflammation And Oxidative Stress1951 Words   |  8 PagesSmad proteins act as primary mediators of inflammatory and fibrotic response [4].Carnosine (ÃŽ ²-alanyl-L-histidine) is a dipeptide with anti-ischemic, anti-oxidant, membrane stabilizing, heavy metal chelating activities, and reduces matrix proteins synthesis such as fibronectin, collagen of podocytes and mesangial cells [5,6]. Material and methods This research was carried out in accordance to the National Institutes of Health guidelines for the care and use of laboratory animals (NIH Publications

Theme of Transformation in Emma - 1209 Words

Emma also transforms into a proper woman through correcting her original neglect. Trollope states that â€Å"[i]n every passage of the book she is in fault for some folly, some vanity, some ignorance, or indeed for some meanness† (7)19. Because of her ignorance toward attitudes of her neighbors, Emma interferes through their lives in a way that makes them unhappy, for â€Å"she had often been negligent† (Austen 359)20. Mr. Knightley predicts the outcome of Emma’s plans in the beginning of the novel when he states that â€Å"[y]ou are more likely to have done harm to yourself, than good to them by interference† (Austen 8)21 and also that â€Å"[v]anity working on a weak head produces every sort of mischief† (Austen 53)22. Not only is Emma stubborn toward her†¦show more content†¦Eugene Goodheart views Emma’s imagination as a â€Å"bending predilection in the antithesis of the romantic sympathetic imagination†36 because Emma cho oses to live in a world that she creates around herself, such as the fantasy that she can marry Harriet Smith off to Mr. Elton. â€Å"She has come to realize to the full how her romantic attempts to marry Harriet such fantasies as to imagine Mr. Knightley in love with her; that the ideas of social hierarchy which Emma had fostered are fantasy† (Brooke)37. Emma’s immaturity only reforms when â€Å"Emma finds through her love of Mr. Knightley that much of her snobbery is false and superficial† (Brooke)38, and Emma is forced into the reality of the hierarchical Victorian society, where she â€Å"is instructed not only by Knightley but also by reality, which crushes her pride and forces her to abandon her delusional system† (Paris)39. Her misunderstandings of people are also seen in her obsessiveness, for â€Å"Emma’s ‘humors’ or obsessions are many, and they give rise to a variety of mistakes and illusions† (Paris)40. Her obsessive ness within her own fantasy leads her to attempting to find a husband for Harriet, which fails. When Emma finally realizes her mistakes, she is able to marry Knightley because â€Å"Emma has learned to balance power and propriety,† which reveals â€Å"Austen’s ideal of a lady as a woman who is strong but not manipulative† (Kohn)41. Another sign of Emma’s original misunderstandings of her society are clear in her judgment. â€Å"EmmaShow MoreRelatedEmma Clueless915 Words   |  4 PagesESSAY PLAN: TRANSFORMATIONS ( EMMA/CLUELESS Intro: C appropriates E’s 19th Century context into a contemp. Beverley Hill’s society embedded in material availability and conspicuous consumption. o Austen’s PURPOSE not changed ( C ( satire of context and human nature ( C has other purp. ( Question value and validity of texts ( POMO TRANSFORMATION THESIS: The transformation of a text helps develop and mold new meaning to its counterpart, and hence deepen the understanding ofRead MoreTransformations: Emma and Clueless1297 Words   |  6 PagesThe universality of themes pervading both Emma and Clueless in correlation with the humanistic, obviously flawed protagonists in both texts, captivates and immerses responders. This engagement leads to an involvement and enjoyment in the composer’s craft, which enables the responders’ to obtain sophisticated insight into the text’s concerns on both subjective and objective levels. Critiques agree that the transformation enables an audience to â€Å"enjoy cultural capital and aesthetic knowledge† whileRead MoreThe Connection Between Clueless and Emma Essay594 Words   |  3 PagesThe Connection Between Clueless and Emma A valuable connection can be made be made between Jane Austens Emma and Amy Heckerlings Clueless although fashion, customs, society and language differ between the two. The connection is made through the plot, characters and inevitable human nature. The themes of vanity, rank, status and gossip link the two medias and create a valuable linkage in relating the 19th century life with the contemporary world. Fashion is constantlyRead MoreAlice in Wonderland, A Different Approach to Organizational Change1717 Words   |  7 Pagesorganization. The case looks at how her own leadership characteristics contributed to the development of an authentizotic culture of trust, affiliation, and meaning for employees, and how the financial situation of the company was turned around as a result. Emma van Nijmegen is a rare example of a female top executive in a typically male dominated industry (Shipping and Transport). This case aims to show how LVVs remarkable turnaround from a loss making company in 1996 to a very profitable market-focused organizationRead MoreThe Transformation Of Social Structure, Values And Personal Relationships1471 Words   |  6 Pagesno part in the judgement of an individual’s character. But are our values really as developed as we believe? The transformation of Austen’s Emma to Clueless highlights the fixed nature of our social structure, values and person al relationships. Through this comparison it becomes evident that many of our current beliefs are not as dissimilar to Austen’s period as we may have thought. Emma depicts marriage as the focus of a women’s life with all achievements and skills of a woman being employed to furtherRead MoreJane Austen s Clueless 1280 Words   |  6 PagesAmy Heckerling’s film ‘Clueless’ enhances our understanding of the transformation derived from Jane Austen’s ‘Emma’ and communicates the issues of rigid social status and confined attitudes to women despite contextual realignments. By adapting the genteel society of Highbury to the superficial microcosm of Beverley Hills, we gain an understanding of the restricted values placed on social status and the objectivity of women. Both Austen’s and Heckerling’s satirical reflections on Regency EnglandRead MoreAnalysis of Themes Found in Emma1131 Words   |  4 PagesThe novel Emma is on e that is funny yet sweet and silly yet quite serious. These words may seem like antonyms to anyone else who has not read the novel but in essence they sum up what is Emma. Emma is a novel that is centered on a girl that is at times silly, vain, self-centered, superfluous, and overly confident yet there is a softer more vulnerable side to her that readers do not really fully grasp until the end of the book. Emma Woodhouse is a girl that says she will never get married yet sheRead MoreA Lesson Before Dying By Ernest J. Gaines926 Words   |  4 Pagesnovel, which kept me on the edge of my seat and had a hard time putting down. The novel explores various themes and concepts that surround the education system, filled with multiple emotional moments, conflicts, and surprising moments scattered throughout the storyline. However, the novel does not just focus on the education system and its underlying issues, but it also focuses on human transformation, where the emotional moments, confli cts, and surprising moments of the novel were most evident. AlthoughRead MoreEmma and Clueless Notes2482 Words   |  10 PagesEmma/Clueless speech Draft thesis: The ideas of appearance vs reality, development of maturity and love are ideas explored through techniques, Appearance vs reality -blindness to truth Emma | Clueless | * Manipulating reality to suit perception of it * Resulting self-deception, confusion, misunderstanding * Dramatic irony empowering us to see through human flaws and social failings of Emma. This often has unexpected results:-Mr Elton’s proposal â€Å"she could have been so deceived...sheRead MoreEmma and Clueless Essay1975 Words   |  8 Pageschange in context of Emma and clueless shaped the values conveyed in the two texts? In Amy Heckerlings 1995 film clueless we see the deep transformation of Jane Austin’s more conservative 19th century classic Emma. In clueless we see the values and themes of high culture literature combined with the modern context of teenage society in the 20th century. The transformation of Jane Austens novel Emma to the 20th century film Clueless by Amy Heckerling allows for the same themes of social structure

Gandhi Essay Example For Students

Gandhi Essay 1-3-98Mike HenryGandhi also known as Mahatma Gandhi was born in Porbandar in the present stateof Gujarat on October 2, 1869 and got his education in law at University College inLondon. On 1891, after having been admitting to the British Bar, Gandhi returned toIndia and attempted to establish a law practice in Bombay, with little success. He wasappalled at the widespread denial of civil liberties and political rights to Indian immigrantsto South Africa. He threw himself into the struggle for elementary rights for Indians. Gandhi remained in South Africa for 20 years. He suffered imprisonment manytimes. During the Boar war, Gandhi organized an ambulance corps for the British armyand commanded a red cross unit. After the war he returned to his campaign for Indianrights. In 1914, the government of the Union of South Africa made important concessionsto Gandhis demands, including recognition of Indian marriages and abolition of the polltax for them. His work in South Africa complete, he returned to India. Following World War I, in which he played an active part in advocatingSalyagraha, launched his movement of passive resistance to Great Britain. Ademonstration against the Roulette Acts resulted in a massacre of Indians at Amritsar bythe British soldiers. In 1920, when the British government failed to make amends, Gandhiproclaimed an organized campaign of noncooperation. Indians in public office resigned,government agencies were boycotted, and Indian children were withdrawn fromgovernment schools. All through India, Indians were squatting on the streets blockingthem. The Indians who refused to leave were beaten by the police. Gandhi was arrested,but the British were soon forced to release him. India completely boycotted British goods. The exploitation of Indian villagers byBritish industrialists had resulted in poverty in the country and the virtual destruction ofIndian home industries. To remedy the poverty, Gandhi advocated the revival of cottageindustries. He began to use a spinning wheel as a token of the return to the simple villagelife he preached. Gandhi became the international symbol of free India. He lived a spiritual life,fasting and meditating. He refused earthly possessions, he wore the loincloth and shawl ofthe lowliest Indian and lived on vegetables, fruit juices and goats milk. Indians thought ofhim as a saint and began to call him Mahatma, meaning great soul. Gandhi was imprisoned off and on over the next several years. In 1930 heproclaimed a new campaign of civil disobedience, asking the Indian population to refuse topay taxes, particularly the tax on salt. He led a mar to the sea, in which thousands ofIndians followed him from Ahmadabad to the Arabian Sea. Once again, he was arrested. Gandhi fasted for long periods several times. His fasts were effective against the British,because revolution might well have broken out in India if he had died. In September1932, while in jail, Gandhi started a fast unto death to improve the status of the IndiaUntouchables. In 1934 Gandhi formally resigned from politics. A few years later, heagain returned. The Mahatma once again became the most important political figure inIndia. By 1944 the Indian struggle for independence was in its final stages. The Britishgovernment had agreed to independence on the condition that the two contendingnationalist groups, the Muslin League and the Congress Party should resolved theirdifferences. India and Pakistan became separate states when the British granted India itsindependence in 1947. During the riots that followed the partition of India, Gandhipleaded with Hindus and Muslims to live together peacefully. On January 13, 1948m 12 days after his last fast, he was on his way to his eveningprayer meeting when he was assassinated by Nathuram Godse, a Hindu fanatic. .u370ec21bac716e85606901f3d7eff5df , .u370ec21bac716e85606901f3d7eff5df .postImageUrl , .u370ec21bac716e85606901f3d7eff5df .centered-text-area { min-height: 80px; position: relative; } .u370ec21bac716e85606901f3d7eff5df , .u370ec21bac716e85606901f3d7eff5df:hover , .u370ec21bac716e85606901f3d7eff5df:visited , .u370ec21bac716e85606901f3d7eff5df:active { border:0!important; } .u370ec21bac716e85606901f3d7eff5df .clearfix:after { content: ""; display: table; clear: both; } .u370ec21bac716e85606901f3d7eff5df { display: block; transition: background-color 250ms; webkit-transition: background-color 250ms; width: 100%; opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #95A5A6; } .u370ec21bac716e85606901f3d7eff5df:active , .u370ec21bac716e85606901f3d7eff5df:hover { opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #2C3E50; } .u370ec21bac716e85606901f3d7eff5df .centered-text-area { width: 100%; position: relative ; } .u370ec21bac716e85606901f3d7eff5df .ctaText { border-bottom: 0 solid #fff; color: #2980B9; font-size: 16px; font-weight: bold; margin: 0; padding: 0; text-decoration: underline; } .u370ec21bac716e85606901f3d7eff5df .postTitle { color: #FFFFFF; font-size: 16px; font-weight: 600; margin: 0; padding: 0; width: 100%; } .u370ec21bac716e85606901f3d7eff5df .ctaButton { background-color: #7F8C8D!important; color: #2980B9; border: none; border-radius: 3px; box-shadow: none; font-size: 14px; font-weight: bold; line-height: 26px; moz-border-radius: 3px; text-align: center; text-decoration: none; text-shadow: none; width: 80px; min-height: 80px; background: url(https://artscolumbia.org/wp-content/plugins/intelly-related-posts/assets/images/simple-arrow.png)no-repeat; position: absolute; right: 0; top: 0; } .u370ec21bac716e85606901f3d7eff5df:hover .ctaButton { background-color: #34495E!important; } .u370ec21bac716e85606901f3d7eff5df .centered-text { display: table; height: 80px; padding-left : 18px; top: 0; } .u370ec21bac716e85606901f3d7eff5df .u370ec21bac716e85606901f3d7eff5df-content { display: table-cell; margin: 0; padding: 0; padding-right: 108px; position: relative; vertical-align: middle; width: 100%; } .u370ec21bac716e85606901f3d7eff5df:after { content: ""; display: block; clear: both; } READ: Child care vs parenting EssayGandhis death was regarded as an international catastrophe. His place inhumanity was measured in terms of history. A period of mourning was set aside in theUnited Nations General Assembly and condolences to India were expressed by allcountries. Religious violence soon waned in India and Pakistan and the teachings ofGandhi came to inspire nonviolent movements elsewhere.

iPad case study MIS free essay sample

Who do you think are the winners and losers of the iPads success? Why ? †¢ iPad can be considered as a disruptive technology because it is achieving success in many fields , specially in media , so many users of normal ways of viewing media are transferring from those traditional ways and start using iPad , so iPad is destroying others popularity and success. The winners are the users and consumers because they are finding their comfort when using iPad , and the providers and suppliers of other industries are the losers as they lose their customers who transfer to iPad and leaving them.3- Describe the effects that the iPad is likely to have on the business models of Apple , content creators and distributers. †¢ Content creators in the past believed that the content is not as important as the device popularity but now , they totally understand that they need a high quality content from all types of media offered by their devices , on the other hand , the companys new goal af ter iPad is to make deals with each media industry to distribute contents at a price agreed to by the content owners and Apple. We will write a custom essay sample on iPad case study MIS or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page Mis in action : 1- iPad is powerful and useful in reading books because it allows you to highlight what you need and gives you the ability to take lots of notes. The iPad is clearly best at the latter two tasks, especially the note-taking. And it keeps getting better in that regard: Amazon recently updated its Kindle iOS app to offer several different colors of highlighter ink, making it easier to color-code your notes in a book as you go. That’s a feature shared by Apple’s iBooks app as well, as both companies work to appeal to the educational and textbook markets , it is powerful in surfing the web as it has the faster browser ever , it is also useful in watching video because of the large screen (10. 1 inch ) and because of the HD screen with millions of colors. The iPads shortcomings are : †¢The screen has too much glare The iPad has the same glossy screen as Apples Macbook Pro laptops and iMac desktops. Unless youre reading in a very dim room, the glare will be noticeable and can be distracting. Outdoors, even in the shade, the glare is really annoying. †¢Problems when reading in the sun If you thought to take your iPad along for an outing in Central Park or at the beach, forget about it. While bright and contrasty indoors, the iPads screen looks washed out and is almost impossible to view in bright sunlight. †¢Fingerprints are annoying Once youve used the iPad for a few minutes, among the most glaring shortcomings (besides the screen glare) are the fingerprints on the screen. With a smartphone, you can wipe the screen on your shirt or pants. The iPad is too big for that. Were wondering what exactly to clean it with and where well keep the cleaning supplies. 2- Comparison between iPad and Kindle tablets. Kindle is better and cheaper compared to IPAD when reading books especially when out in the sunlight. The glare is just impossible.the kindle paperwhite is just like reading a book and you can see the words clearly in sunlight. The Kindle Paperwhite boasts adjustable edge-lighting and a crisp, white E-ink display that enable comfortable reading in any environment. It also integrates with the best eBook store in the businessA Kindle owner can keep reference material, books for pleasure, business manuals and reading material for friends and family on a single device that fits easily into a backpack, briefcase or purse . E-books are available for purchase and download as gifts, and Kindle book gift cards can be purchased so that a recipient may make personal choices. Bookmarks, highlighting and search features are available on all versions of Kindles. The devices allows bookmarks and note-taking within the screen. When a user turns off a Kindle, the device remembers where the reader left off; when the user turns the Kindle back on, the book is restored to the last page the reader visited. Using a Kindle gives a user access to Kindle-only books, pamphlets andinformation. For example, author Stephen King wrote a novella specifically for the Kindle. Kindle also allows unencrypted forms of data to be stored on the device, such as . TXT files; Kindle 2 and newer versions allow . PDF files to be read.. 3- I would like to use traditional print publications because Ill be able to copy whatever I want to use later or to give it to friends , it also give me the ability to sketch and highlight on paper and I ca n write things easily on the pages.