Tuesday, January 28, 2020

PPDP provides skills level mapping tool

PPDP provides skills level mapping tool OUT Come 14; Demonstrate responsibility for ones own learning through the development of a portfolioof practice and recognise when further learning is required. Evidence Doc; P1S3R32(Reflection on placement 1) One of the important learning from my 1st placement is the development of personal and professional development portfolio (PPDP). PPDP provides skills level mapping tool and planning for further skills (Wenzel et al 1998).PPDP is developed by nurses and other health care professionals in their professional career (Oermann 2002). When I started my placement, I have no idea; Why I need to develop PPDP? What is the importance of PPDP and how PPDP helps in building up personal and professional development (Trossman 1999)? Soon, I could understand the fact that PPDP are reflection of nurses skill level and provides a tool for development of professional skills (Kelly 1995). My PPDP consists of three main components; Assessment of skills including self, peers and mentors assessments, preparation of action plans for further development and reviews of achieved skills at various intervals. In developing the first part of my PPDP, I looked at essential skill clusters recommended by NMC for nurses (Semple et al 2003) and then I evaluated my current skill levels before developing my PPDP. A nurse should evaluate personal and professional skills throughout his/her professional career (Meeks et al 1995). Actually, it is a time of competition and perfection. In the environment of constant competition and improvement, the knowledge and skills required to enter nursing practice are never sufficient (Cary et al 2005). Therefore, it is recommended for nurses to improve their essential skills through development of PPDP (Cayne 1995). In the first part of my PPDP, I took assessment of my current skills through self evaluation, assessment by my mentor and by taking views of my peers and even clients views on my essential skills to become a good professional nurse. PPDP is an assessment tool for ones skills level (Lettus et al 2001). PPDP are used for continued personal and professional development of nurses (Meister et al 2002). Similarly, I could know that I was deficient in some skills like communication, addressing client, keeping confidentiality etc. By developing PPDP, I also identified that I need to develop some new skills to reach nursing professional standard. First, I thought that only my self assessment is sufficient to evaluate my current skills level. However, there was a question in my mind; Can we rely on self assessment only? The answer comes in No in a study conducted on physician whom self assessment were different than assessment done by external agencies (Davis et al 2006). Then I thought why only self assessment is not sufficient to evaluate ones own skill level. Actually, the assessment of PPDP depends upon assessors individuality (McMullin et al 2004). The angle, way of thinking and thinking approach of myself may be different than others. Secondly other observers like my peers and mentor would be more experienced than me and can reflect more perfectly on my deficiencies and weaknesses in my skills. An external assessor looks at the competencies or the extent of learning in comparison of individuals capacity of self evaluation ( Davis et al 2006). Self assessment could be wrong or weak (Forker et al 1996). Therefore self asse ssment should be counter checked by feedback from experienced people. In performing the evaluation of my skills level, I therefore used not only my self assessment but also feedback from my mentor and peers. Development of PPDP is used to enhance learning skills and abilities by keeping records of current essential skills and planning for development of future skills (Hoban 2003). In developing my PPDP, I recorded my trainings, qualifications and achievements in one compartment. Portfolios are individualised, organised, selective, ongoing and reflective (Hall et al 1996). Similarly, my portfolio would be different from others in arrangement and collection of myself information. I have started developing my PPDP in my first placement but it will continue throughout my training and later on in my professional career. The second compartment of my PPDP consists on action plans for development of my deficient skills and need for new skills. Development of action plans seemed to be not much important to me at the beginning of my placement. But later on, I could understand the value of action plans, without those, I could not be able to look at my deficient skills and could not take necessary steps to learn new skills. PPDP are also used as past reference of learning weaknesses and thus lead to avoid further errors in future (Karlowicz 2000). Similarly, I could find out where I have made mistakes in my first placement. For example, I was using real name of client in my reflection but my mentor asked me to used fictitious names for DATA protection act. Thus I could know the importance of confidentiality and decided not to disclose clients information without his/her consent. Again the development of action plans were a difficult job and only my understanding was not sufficient. Therefore, action plans were developed and agreed with my mentor in my supervisions. The third part of my PPDP consists on assessment reviews. It is the stage where achievement of new skills and improvement of current skills are evaluated and further developmental needs are identified (Tiwari et al 2003). I took my skill assessment reviews with my mentor. My mentor looked at last action plans and identified my achieved skills since my last action plan. Assessment reviews are also focused on needs to develop further skills in a PPDP (Weinstein 2002). Assessment reviews identify issues in PPDP where student fails to achieve required skill level (Moses 2000). Similarly, my mentor found out few skills which I could not achieve due to non-opportunity at the placement site. I have decided to use assessment reviews in my PPDP to enhance my existing skills to the professional level of nursing standard recommended by NMC (UKCC 1992). SUMMARY I learnt from development of PPDP that I can make assessment of my skills not only by self assessment but with the help of feedback from other staff and experienced people like my mentor. I can use action plans for development of my further development in the light of feedback received by my peers, mentor, myself assessment and clients view. I can use assessment reviews to identify achievement of new skills, improvement of current skills and planning for further developmental needs. OUT Come 12; Demonstrate an understanding of the role of others by participating in inter-professional working practice. . Evidence Doc; P1S3R25(Reflection on community team meeting) I started my first placement at community mental health services. I had no idea about community mental health teams (CMHT) when I started my placement. How CMHT works? Who co-ordinate CMHT activities? Who take first intervention and at what level? How clients are referred to CMHT or how client find help from CMHT? These were all question in my mind at the beginning of my placement. I could not have chance to understand the working pattern of CMHT if I had not got a chance of getting an experienced and skilled mentor with central role in CMHT. My mentor works as care- coordinator in CMHT. Therefore, I have an advantage to learn inter-professional practice of my mentor among multidisciplinary team (MDT). I found that community mental health services run through MDT (Caldwell et al 2003). MDT consists on healthcare professionals, medics, social workers, care and support workers and consultants (OConnor et al 2006). A mental health nurse participates in MDT (Van 2004). In the beginning I was confused with an idea that why a single team could not be able to provide mental health services in community. Actually MDT work together to provide care to mental health clients (Clarke 2004). Diversity of knowledge, experience and skills in MDT members provide advantage to treat various mental health issues at multidisciplinary levels (Ellefsen 2002). However, there should always be an individual with central role to coordinate and collate the activities of MDT into a successful pattern to provide mental health services to client. Such a role of inter-professional working practice was my mentors job role. The MDT at my placement site consists on continuing care team, early intervention team and crisis intervention team. In addition to these teams at placement sites, other community mental health teams like transcultural team, community day services, home treatment team and various volunteer and trust organizations like MIND, RETHINK, SPACE, Fitzwilliam center participate in MDT. Each community care team consists on individuals of various behaviour, knowledge, skills and experience. My team was continuing care team consisting on three members from various professions, experience and knowledge. My team interacts with other teams and health professionals during meetings and in providing support to client. I have got chance to look at interaction of my mentor with members of other MDT members. For example, in community meetings, my mentor took feedback from other team members and provided updating on care issues of mental health clients. Each case is discussed individually and any progress or deterioration is discussed and evaluated (Elkan et al 2000). My mentor plays a vital role in co-coordinating, monitoring and supervising inter-professional activities while caring for mental health clients. For example, a clients family was much worried about the client as they were going away for two day. The client was on Methadone and has taken detox treatment from Fitzwilliam center in last few months. However he has been taking over dose of a medicine named Zopliclone tab in last few weeks. There was risk of leaving him alone at home. The family has not taken an opportunity of recreation for long time. On this weekend family decided to go on beach for two days. Family was much worried about the client. There were multiple aspects in the care of client. On one hand clients safety was issue and on the other hand family worry needs to be considered. Furthermore, methadone dosage need reviewing, clients habit to take over dosage of Zopliclone tablet need to be considered. Many members of MDT seemed to be involved in one clients needs. Therefore, my mentor organized inters professional practice. He explained in meeting that he has arranged support worker to keep close contact with client. My mentor also contacted to home treatment team to visit client every day. In addition to that my mentor will be visiting to client as well. He requested to social worker to ensure family that the client will be safe. My mentor also mentioned that he has contacted Fitzwilliam center to review methadone dosage as client seemed to be fit on less dosage. In addition to that my mentor has contacted to GP t o review clients medication under recent changes. Actually, my mentor act to inter connects various healthcare professionals activities while providing care to the client. Thus I learnt that a care-coordinator carry out inter professional practice to combine individual efforts of care in the form of a united care plan for clients care, management. SUMMARY The role of my mentor as care co-coordinator in his inters professional working practice was enough observation for me to understand his role in organizing various professional activities. Inter- Professional practice co-ordinate activities between various health professionals. Inter- Professional practice combine efforts of various healthcare professionals to result in a united and single agreed care plan. Each member of MDT receives multiple feedbacks from various members of MDT and feedback may oscillate forward and backward creating a sense of care and treatment. For example if my mentor has not organized inter professional practice, home treatment team could not care the client at home, social worker could not know about the risk involved in leaving client alone and GP would not get feedback regarding reviewing Tab Zopliclone and changing it with less adaptive sleeping tablet. OUT Come 10; Recognose situation in which agreed plans of nursing careno longer appear appropriate and refer these to an accountable practitioner. Evidence Doc; P1S3R21(Reflection onfollow up of client LD) When I started placement, it looked impossible for me to review a care plan and to feel need to review a care plan. I was not sure, why a care plan change? How a care plan change? What are the circumstances which may change clients care plan? My initial understanding was review of a care plan at regular and fixed intervals. But my understanding about review of care plan changed when I made visits to client Ld in the supervision of my mentor. Care plans are agreed plans for providing nursing care to clients (Baker 2003). Care plans are prepared after risk assessments and client involvement. (Olofsson et al 2000). Care plans are reviewed after regular intervals but may change immediately followed by some major changes in risk assessments associated to a client. This happened when Client Lds risk assessment change followed by changes in circumstance and therefore care plane was reviewed. I made visits to client Ld with my mentor. History of Ld goes back to the time when her immigration status was changed. Ld belongs to an area where army revolution has caused many sad incidences. Rape of young girls was common and Ld was one of these victims. Ld could escape to UK and applied for asylum but could not prove evidence. Resultantly her asylum was refused. As a result of stress, Ld started getting obsessions of rape and got fits as well due to fear and anxiety of going back to same environment. The changes in Lds circumstance were negative as her mental health and socio-economical status was deteriorated. I got information by looking at Client Lds history that a care plan was revised first time when Client Ld started getting fits. Ambulance services were called and Ld was hospitalized. Then Crisis team revised care plan at first time. According to care plan, Ld was treated for mental illness called schizophrenia (Lysaker et al 2010). She was also provided free legal aid to appeal for her immigration status. Lds anxiety and insomnia was also considered as risk factor for Lds mental health. At the time, Lds immigration status was refused; she was living in shared accommodation. Financial resources were not very good as she was provided very little money in addition to shared accommodation. Then she started obsession and fits. It was the first time when Lds care plan was changed in response to quick changes. As anxiety and stress was considered as a cause of fits, a supported accommodation was planned. Medication for obsession (Tab Clozapine) and insomnia and anxiety (Tab Lorazepam) was prescribed by GP and was a part of care plan. A social worker and interpreter were also allocated to Ld for assistance in living and reducing anxiety and stress. This was the first time; I observed change in Lds care plan following by an abrupt change in Lds circumstances. The cause or change in Lds circumstances was negative as Lds mental issue and vulnerability was deteriorated. Therefore, a close observation with more precise care was recommended in care plan. When I looked at Lds mental health history and crisis teams intervention, I could understand that crisis team reviewd care plan after evaluating potential risk factors. My direct observation (when Lds care plan was changed at second time followed by change in her circumstances) was the time when Lds circumstance has positively improved. It was the second occasion when Lds care plan was changed following a steep change in her circumstance. It was the time when Lds asylum has been accepted and Ld started getting improved in her mental illness. She has not got fits for a long time. She has started living in supported accommodation. She has started going out in community to make friends and having coffee at coffee evening. Ld is due to Start College in September. I observed that it was positive change in circumstance as compared to negative changes when Lds mental health deteriorated in first intervention. I could conclude that why my mentor was suggesting review of Lds care plan. Actually risk assessment has changed as risk factors for Lds mental health are reduced. Need for medication has changed. Therefore, my mentor felt a review of medication and r eferred client to consultant for medication review. The same dose of Tab Lorazepam was causing more sleep than required for calmness when clients anxiety was high. Client Lds improvement in mental health status has identified her needs for social interaction and therefore an independent accommodation was recommended in reviewed care plan. As Client Lds social interaction will increase soon, she will need more financial help. As a result of success in asylum, Ld deserves more financial aid now. Therefore it was recommended in care plan to help Ld to apply for her benefits. As Ld would be getting more financial help, it was felt that Ld should be provided help in managing her budget as she will be living independently. Therefore, social worker was requested to help Ld making her monthly budget. It was also a part of reviewed care plan. Clients participation and consultation from experts are final steps in care plan review (Hunt et al 1994). Client Ld was involved in care plan review at all stages. My mentor asked her at each step of review if she was happy with changes in care plan. A final opinion was taken from consultant before finally reviewing Lds care plan. Client Ld case has provided me understanding that a care plan goes out of date when personal, mental health, financial and social issues change. The change in circumstance may be positive in case of improvement or negative in case of deterioration of mental health issues or socio-economical issues. Lds case is a perfect example of care plan review followed by positive and negative changes in circumstances. (Word limit 2750) SUMMARY Learning from client Lds case Is practical experience of stress vulnerability model (Zubin et al 1977). Was needed to change in care plan followed by an immediate change in circumstances of a client. For example, client Lds circumstance change twice times. Once negatively when crisis team drafted first care plan and secondly as positively when my mentor reviewed her care plan. I can understand that care plans are reviewed followed by any change in clients mental health issues and other circumstances resulting in changes in risk assessment. CONCLUSION The placement has provided me clear idea and good understanding of the skills required to be a professional mental health nurse. I learnt about development of PPDP, care plans review followed by immediately changes associated to a client environment, the role of a care coordinator to work in inter-professional practice and many other essential skills to become a professional mental health nurse. In developing a PPDP, I learnt making initial assessment of skills required to reach nursing standards, preparation of action plans to identify past mistakes, future planning for skills and review of skills at the end of each action plan duration. I learnt the inter professional practice of a health care professional (my mentor at my placement) to organize and unite efforts of various healthcare professionals in creating a single united care plan for client. I also learnt to review care plan if there is change in risk assessment for client. REFERENCE Caldwell K, Atwal A, 2003,The problems of interprofessional healthcare practice in hospitals. Brf Nurs,12:1212-18. Cayne,J.V.,1995.Portfolio: a developmental influence. Journal of Advanced Nursing,21,395-405. Cary AH, Smolenski MC.2005, Overview of competency and the methods for evaluating continued competence. American Nurses Association 1-10 Clarke, J.2004.Public health nursing in Ireland. A critical overview. Public health Nursing,21(2),191-198. Davis DA, Mazmanian PE, Fordis M, Harrison RV, Thorpe KE, Perrier L.2006, Accuracy of physician self assessment compared with observed measures of competence. J Am Med Assoc; 296-9;1094-1102. Elkan, R., Blair,M., robinson, J, 2000. Evidance based practice and health visiting;The need for theoretical underpinnings of evaluation. Journal of Advanced Nursing,31(6),1316-1323. Ellefesen, B,2002. The experience of collaboration; A comparison of health visiting in Scotland and Norway. International Nursing Review, 49(3),144-153. Forker,J.E, McDonald,M.E, 1996. Methodological trends in healthcare professions; portfolio assessment. Nurse Educator,21(5),9-10. Hoban,V.,2003.Careers-How to get the most from your portfolio? Nursing Times 99(17),58-59. Karlowicz, K.A,2000. The valueof student portfolio to evaluate undergraduate nursing programme. Nurse Educator(25) Kelly, J,1995. The really useful guide to portfolio and profiles. Nursing Standards, 9(32), 4-8 Lysaker, Paul H, Jamie, Christina, alan, Tina,2010. Personal narratives and recovery from Schizophrenia. Schizophrenia research, 121 (1-3). P.271-276. Lettus, M.K, Moessner, P.H., Dooly, L., 2001. The clinical portfolio as an assessment tool. Nursing Administration, Quarterly(25),74-80. McMullan M, Endacott R, Gray MA, Jasper M, Miller CML, Scholes J, Webb C.2003, Portfolio and assessment of competence; A review of the literature. Journal of Advanced Nursing, 41-3;283-294. Meeks, A., Hayes,T.,Stahlhammer,S., Zeaply,M, 1995. Evaluation by portfolio. Nursing Mnangement. 26(8),72-74. Meister,L.,Heath, J., Andrews,J., Tingen, M.s.,2002. Professional nursing portfolio; a global perpective. Medsurg, Nursing (11), 177-183. Moses, V., 2000. Record in nursing. The Nurse in Israel (161),12-14. Oermam, M.H., 2002. Developing a professional portfolio in nursing. Orthopaedic Nursing. 21(2),73-78. Olofsson, B., Norberg, A.2000. Experiences of coercion in psychiatric care as narrated by patients, nurses and physicians. Journal of Advanced Nursing, 33(1),89-97 OConnor M, Fisher C, Guilfoyle A 2006. Interdisciplinary teams in pallayive care ;a critical reflection. International Journal of Palliative Nursing.12(3)[132-137 Seguin TJ. 2005. The concept of the portfolio. American Nurses Association and International society of Nurses in Genetics;11-24. Semple M, Cable S, 2003, The new code of professional conduct. Nurs Stand. 19-25;17(23);40-8. Tiwari, A., Tang, C, 2003. From process to outcome; the effect of portfolio assessment on student learning. Nurse Education Today; 23(4), 269-277. Trossman, S., 1999. The professional portfolio; documenting who you are, what you do? American Nurse. 31(2), 1-3. Van Offenbeek M.A.2004, The organizational and performance effects of nurse practitioner roles, Journal of Advanced Nursing, 47, 672-681. Wittenberg-Lyles Em, 2005, Information sharing in interdisciplinary team meetings; An evaluation of hospice goals. Qualitative Health Research, 15;13, 77-1391. Weinstein, S.M, 2002. A nursing portfolio; documenting your professional journey. Journal of Infusion Nursing, 25(6),357-364. Wenzel, I.S., Briggs, K.L., Puryear, B.L., 1998. Portfolio; authentic assessment in the age of the curriculum revolution. Journal of Nursing Education. 37(5),208-212. Zubin.J, Spring.B. 1977, Vulnerability; A new view on Schizophrenia. Journal of abnormal Psychology; 86, 103-126. BIBLIOGRAPHY Barker, p. 2003. Psychiatric and mental health nursing; The craft of caring. London; Arnold. Hall, C., Redfern, L., 1996. Profiles and portfolios; a Guide for Nurses and Midwives. MacMilliam by J.Press (Padstow) Ltd. London. Hunt G, Wainwright P (1994).Expanding the role of the Nurse. Blackwell Scientific, Oxford. UKCC, 1992, The Scope of professional practice. UKCC, Code of professional conduct. NMC, London.

Monday, January 20, 2020

Parents :: Relationships Parenting Essays

Parents Pushy parents are a very touchy subject to talk about. When it comes to the well fare of children, people are always ready to jump and point fingers at others without gathering the facts. The parents of theatre, gifted, and talented children get these nasty fingers pointed at them and most are due to the generalization that the media has made portraying these parents as mean, self righteous, and abusive. The honest truth is that parents care for their children and are not pushy, but instead they direct their children in becoming good adults by protecting them, encouraging them, and being dedicated to them. In his review of The Trouble With Perfect/The Successful Child/Positive Pushing (Book), Douglas C. Lord talks about the role of the parent. The role of the parent is to protect their children and provide for them all they can to insure that they have the proper tools in order to be successful in life. These tools include such things as having good morals, strong work ethics, phenomenal character, etc. Providing their kids with the mentioned tools, parents protect their kids from becoming failures in life and give them the option to make something of themselves, which far exceeds the expectations of their parents. Parents have to do these things in order to direct their kids. This is believed to be an â€Å"absolute moral imperative† (Lord). If your parents did not provide you with these tools, where would you be? â€Å"Pageant moms are the worst,† is something that I heard once. This I have to say is false. The moms and dads of the performing art children have to be the most dedicated parents I personally have ever seen. These parents spend all of their time and energy helping their kids exceed and they always remind their kids of how much they love them. These are almost the craziest and most fanatic parents of them all. They follow their children from competition to competition, from performance to performance, from dance class to rehearsals. These parents are always there and are always willing to help.

Sunday, January 12, 2020

Leadership Incident Essay

Companies differ markedly in their ability to produce future leaders, as several recent analyses of the 1,187 largest publicly-traded U.S. companies revealed. Among the CEOs in one study, a remarkable total of 26 once worked at General Electric (GE). But as the table below shows, on a per-employee basis that earns GE only tenth place in terms of the likelihood of a current or former employee’s becoming CEO of a large company. Top on the list is management consulting firm McKinsey & Company. Amazingly, if we extrapolate into the future from the current stock of McKinsey alums who are CEOs, of every 690 McKinsey employees, one will become CEO of a Fortune 1000 company. Some companies did not fare nearly as well, such as Citigroup (odds: 30,180:1), AT&T (odds: 23,220:1), and Johnson & Johnson (odds: 15,275:1). While some might dismiss the results, not surprisingly, the companies at the top of the list do not. â€Å"We are a leadership engine and a talent machine,† said retiring P&G CEO A. G. Lafley. Questions 1. Management consulting firms did very well on a per-employee basis, partly because they are mostly comprised of managers (as opposed to blue-collar or entry-level workers). How big a factor do you think composition of the workforce is in likelihood of producing a CEO? 2. Do you think so-called leadership factories are also better places for non-leaders to work? Why or why not? 3. Assume you had job offers from two companies that differed only in how often they produced CEOs. Would this difference affect your decision? 4. Do these data give any credence to the value of leader selection and leader development? Why or why not? Based on D. McCarthy, â€Å"The 2008 Best Companies for Leaders,† Great Leadership (February 17, 2009), http://www.greatleadershipbydan.com/2009/; F. Hansen, â€Å"Building Better Leaders†¦Faster,† Workforce Management (June 9, 2008), pp. 25-28; D. Jones, â€Å"Some Firms’ Fertile Soil Grows Crop of Future CEOs,† USA Today (January 9, 2008), pp. 1B, 2B.

Friday, January 3, 2020

Spy Jobs at the CIA

So, you want to be a spy. The first place most people hoping to land a spy job usually look is the U.S. Central Intelligence Agency (CIA). Though the CIA never has and never will use the job title â€Å"Spy,† the agency does hire a few select people whose job is to gather military and political intelligence from around the world—in essence, spies. Life as a CIA Spy While the CIA offers a wide range of more traditional job opportunities, its Directorate of Operations (DO), formerly called the National Clandestine Service (NCS), hires â€Å"Covert Investigators† who—by any means necessary—gather information needed to protect U.S. interests in foreign countries. This information is used to keep the President of the United States and Congress apprised of threats of terrorism, civil unrest, government corruption, and other crimes.   Once again, a CIA spy job is not for everyone. Looking only for â€Å"the extraordinary individual who wants more than a job,† the Directorate of Operations calls spying â€Å"a way of life that will challenge the deepest resources of your intelligence, self-reliance, and responsibility,† demanding â€Å"an adventurous spirit, a forceful personality, superior intellectual ability, toughness of mind, and the highest degree of integrity.† And, yes, a spy job can be dangerous, because, â€Å"You will need to deal with fast-moving, ambiguous, and unstructured situations that will test your resourcefulness to the utmost,† according to the CIA. ThoughtCo / Vin Ganapathy Careers at the CIA For people who consider themselves up to the many challenges of working as a spy, the CIA’s Directorate of Operations currently has four entry-level positions for qualified job seekers who have completed extensive agency training programs. Core Collectors and Operations Officers spend most of their time abroad recruiting, handling, and protecting persons who provide foreign HUMINT— human intelligence.Core Collectors and Collection Management Officers manage the work of the Core Collectors and Operations Officer, and evaluate and distribute the HUMINT they gather to the U.S. foreign policy community and intelligence community analysts.Staff Operations Officers act as liaisons between the CIA’s U.S. headquarters and field officers and agents overseas. They travel extensively and must be experts in either specific world regions or threats like terrorism.  Specialized Skills Officers might work anywhere using their military experience, or specialized technical, media, or language skills to conduct or support all CIA operations. Job titles in these areas include Collection Management Officer, Language Officer, Operations Officer, Paramilitary Operations Officer, Staff Operations Officer, and Targeting Officer. Depending on the position for which they applied, successful entry-level job candidates will go through the CIA’s Professional Trainee Program, the Clandestine Service Trainee Program, or the Headquarters Based Trainee Program. After successfully completing the training program, entry-level employees are assigned to a career track based matching his or hers demonstrated experience, strengths, and skills to the current needs of the agency. CIA Spy Job Qualifications All applicants for all CIA jobs must be able to provide proof of U.S. citizenship. All applicants for jobs in the Directorate of Operations must have a bachelors degree with a grade point average of at least 3.0 and qualify for government security clearance. Applicants for jobs involving gathering human information must be proficient in a foreign language—the more the better. Hiring preference is generally given to applicants with demonstrated experience in the military, international relations, business, finance, economics, physical science, or nuclear, biological or chemical engineering. As the CIS is quick to point out, spying is a career dominated by stress. People lacking strong stress management skills should look elsewhere. Other helpful skills include multitasking, time management, problem-solving, and excellent written and verbal communication skills. Since intelligence officers are often assigned to teams, the ability to work with and lead others is essential. Applying for CIA Jobs Especially for spying jobs, the CIA’s application and vetting process can be trying and time-consuming.   Much like in the movie â€Å"Fight Club,† the CIA’s first rule of applying for spy jobs is never tell anybody you are applying for a spy job. While the agency’s online information never uses the word â€Å"spy,† the CIA clearly warns applicants never to reveal their intention to be one. If nothing else, this proves the future spy’s much-needed ability to hide his or her true identity and intentions from others. Jobs in the Directorate of Operations can be applied for online on the CIA’s website. However, all prospective applicants should carefully read about the application process before doing so. As an added level of security, applicants are required to create a password-protected account before proceeding with the application. If the application process is not completed within three days, the account and all information entered will be deleted. As a result, applicants should make sure they have all of the information needed to complete the application and plenty of time to do so.  In addition, the account will be disabled as soon as the application process is completed. Once the application is completed, applicants get an on-screen confirmation. No mail or email confirmation will be sent. Up to four different positions can be applied for on the same application, but applicants are asked not to submit multiple applications. Even after the CIA accepts the application, pre-employment evaluation and screening may take as long as a year. Applicants who make the first cut will be required to undergo medical and psychological testing, drug testing, a lie-detector test, and an extensive background check. The background check will be structured to assure the applicant can be trusted, cannot be bribed or coerced, is willing and able to protect sensitive information, and has not or ever has pledged allegiances to other countries. Because much of a CIA spy’s work is done covertly, even heroic performance rarely gets public recognition. However, the agency is quick to recognize and reward outstanding workers internally. Directorate of Operations employees serving abroad get competitive pay and benefits including lifetime health care, free international travel, housing for themselves and their families, and educational benefits for their family members.

Thursday, December 26, 2019

Rna Extraction Cdna Synthesis And Real Time Pcr For...

RNA extraction, cDNA synthesis and real-time PCR for Smad3 gene Total RNA was extracted from frozen kidney tissues after processing using Qiagen RNeasy Total RNA isolation kit (Qiagen, Hiden, Germany) according to the protocol provided by the manufacturer, followed by synthesis of the first strand using SuperScript  ® III First-Strand Synthesis System for RT-PCR kit (Life Technologies) according to the manufacturer’s instructions. PCR reactions were performed using Power SYBR Green PCR Master Mix (Life Technologies) following the manufacturer’s instructions. Smad3 mRNA transcripts were quantified, relative to the housekeeping gene, glyceraldehyde-3-phosphatedehydrogenase (GAPDH) which was used as an internal control. Sequence specific primers were designed by Primer3 software: (http://bioinfo.ut.ee/primer3/) as follows: rat Smad3 forward primer (5 - AGGGCTTTGAGGCTGTCTACC-3 ) and reverse primer (5 - ACCCGATCCCTTTACTCCCA -3 ) (GenBank Accession No. NM_016769.4); rat GAPDH forward primer (5†²-GGTGAAGTTCGGAGTCAACGGA-3†²) and reverse primer (5†²-GAGGGATCTCGCTCCTGGAAGA-3†²) (GenBank Accession No. NM_017008). The final results were automatically calculated from the cross-point values of the target and the reference gene by Rotor-Gene Q 6plex and its specific software (Qiagen, Valencia, CA, USA). Statistical analysis Statistical analysis was conducted as mean and standard deviation using Statistical Package for Social Sciences (SPSS), version 16.0 for Windows (SPSS, Chicago, IL).Show MoreRelatedEnvironmental Pollutants, Drug And Ionizing Radiation Causes Inflammation And Oxidative Stress1951 Words   |  8 PagesSmad proteins act as primary mediators of inflammatory and fibrotic response [4].Carnosine (ÃŽ ²-alanyl-L-histidine) is a dipeptide with anti-ischemic, anti-oxidant, membrane stabilizing, heavy metal chelating activities, and reduces matrix proteins synthesis such as fibronectin, collagen of podocytes and mesangial cells [5,6]. Material and methods This research was carried out in accordance to the National Institutes of Health guidelines for the care and use of laboratory animals (NIH Publications

Wednesday, December 18, 2019

Theme of Transformation in Emma - 1209 Words

Emma also transforms into a proper woman through correcting her original neglect. Trollope states that â€Å"[i]n every passage of the book she is in fault for some folly, some vanity, some ignorance, or indeed for some meanness† (7)19. Because of her ignorance toward attitudes of her neighbors, Emma interferes through their lives in a way that makes them unhappy, for â€Å"she had often been negligent† (Austen 359)20. Mr. Knightley predicts the outcome of Emma’s plans in the beginning of the novel when he states that â€Å"[y]ou are more likely to have done harm to yourself, than good to them by interference† (Austen 8)21 and also that â€Å"[v]anity working on a weak head produces every sort of mischief† (Austen 53)22. Not only is Emma stubborn toward her†¦show more content†¦Eugene Goodheart views Emma’s imagination as a â€Å"bending predilection in the antithesis of the romantic sympathetic imagination†36 because Emma cho oses to live in a world that she creates around herself, such as the fantasy that she can marry Harriet Smith off to Mr. Elton. â€Å"She has come to realize to the full how her romantic attempts to marry Harriet such fantasies as to imagine Mr. Knightley in love with her; that the ideas of social hierarchy which Emma had fostered are fantasy† (Brooke)37. Emma’s immaturity only reforms when â€Å"Emma finds through her love of Mr. Knightley that much of her snobbery is false and superficial† (Brooke)38, and Emma is forced into the reality of the hierarchical Victorian society, where she â€Å"is instructed not only by Knightley but also by reality, which crushes her pride and forces her to abandon her delusional system† (Paris)39. Her misunderstandings of people are also seen in her obsessiveness, for â€Å"Emma’s ‘humors’ or obsessions are many, and they give rise to a variety of mistakes and illusions† (Paris)40. Her obsessive ness within her own fantasy leads her to attempting to find a husband for Harriet, which fails. When Emma finally realizes her mistakes, she is able to marry Knightley because â€Å"Emma has learned to balance power and propriety,† which reveals â€Å"Austen’s ideal of a lady as a woman who is strong but not manipulative† (Kohn)41. Another sign of Emma’s original misunderstandings of her society are clear in her judgment. â€Å"EmmaShow MoreRelatedEmma Clueless915 Words   |  4 PagesESSAY PLAN: TRANSFORMATIONS ( EMMA/CLUELESS Intro: C appropriates E’s 19th Century context into a contemp. Beverley Hill’s society embedded in material availability and conspicuous consumption. o Austen’s PURPOSE not changed ( C ( satire of context and human nature ( C has other purp. ( Question value and validity of texts ( POMO TRANSFORMATION THESIS: The transformation of a text helps develop and mold new meaning to its counterpart, and hence deepen the understanding ofRead MoreTransformations: Emma and Clueless1297 Words   |  6 PagesThe universality of themes pervading both Emma and Clueless in correlation with the humanistic, obviously flawed protagonists in both texts, captivates and immerses responders. This engagement leads to an involvement and enjoyment in the composer’s craft, which enables the responders’ to obtain sophisticated insight into the text’s concerns on both subjective and objective levels. Critiques agree that the transformation enables an audience to â€Å"enjoy cultural capital and aesthetic knowledge† whileRead MoreThe Connection Between Clueless and Emma Essay594 Words   |  3 PagesThe Connection Between Clueless and Emma A valuable connection can be made be made between Jane Austens Emma and Amy Heckerlings Clueless although fashion, customs, society and language differ between the two. The connection is made through the plot, characters and inevitable human nature. The themes of vanity, rank, status and gossip link the two medias and create a valuable linkage in relating the 19th century life with the contemporary world. Fashion is constantlyRead MoreAlice in Wonderland, A Different Approach to Organizational Change1717 Words   |  7 Pagesorganization. The case looks at how her own leadership characteristics contributed to the development of an authentizotic culture of trust, affiliation, and meaning for employees, and how the financial situation of the company was turned around as a result. Emma van Nijmegen is a rare example of a female top executive in a typically male dominated industry (Shipping and Transport). This case aims to show how LVVs remarkable turnaround from a loss making company in 1996 to a very profitable market-focused organizationRead MoreThe Transformation Of Social Structure, Values And Personal Relationships1471 Words   |  6 Pagesno part in the judgement of an individual’s character. But are our values really as developed as we believe? The transformation of Austen’s Emma to Clueless highlights the fixed nature of our social structure, values and person al relationships. Through this comparison it becomes evident that many of our current beliefs are not as dissimilar to Austen’s period as we may have thought. Emma depicts marriage as the focus of a women’s life with all achievements and skills of a woman being employed to furtherRead MoreJane Austen s Clueless 1280 Words   |  6 PagesAmy Heckerling’s film ‘Clueless’ enhances our understanding of the transformation derived from Jane Austen’s ‘Emma’ and communicates the issues of rigid social status and confined attitudes to women despite contextual realignments. By adapting the genteel society of Highbury to the superficial microcosm of Beverley Hills, we gain an understanding of the restricted values placed on social status and the objectivity of women. Both Austen’s and Heckerling’s satirical reflections on Regency EnglandRead MoreAnalysis of Themes Found in Emma1131 Words   |  4 PagesThe novel Emma is on e that is funny yet sweet and silly yet quite serious. These words may seem like antonyms to anyone else who has not read the novel but in essence they sum up what is Emma. Emma is a novel that is centered on a girl that is at times silly, vain, self-centered, superfluous, and overly confident yet there is a softer more vulnerable side to her that readers do not really fully grasp until the end of the book. Emma Woodhouse is a girl that says she will never get married yet sheRead MoreA Lesson Before Dying By Ernest J. Gaines926 Words   |  4 Pagesnovel, which kept me on the edge of my seat and had a hard time putting down. The novel explores various themes and concepts that surround the education system, filled with multiple emotional moments, conflicts, and surprising moments scattered throughout the storyline. However, the novel does not just focus on the education system and its underlying issues, but it also focuses on human transformation, where the emotional moments, confli cts, and surprising moments of the novel were most evident. AlthoughRead MoreEmma and Clueless Notes2482 Words   |  10 PagesEmma/Clueless speech Draft thesis: The ideas of appearance vs reality, development of maturity and love are ideas explored through techniques, Appearance vs reality -blindness to truth Emma | Clueless | * Manipulating reality to suit perception of it * Resulting self-deception, confusion, misunderstanding * Dramatic irony empowering us to see through human flaws and social failings of Emma. This often has unexpected results:-Mr Elton’s proposal â€Å"she could have been so deceived...sheRead MoreEmma and Clueless Essay1975 Words   |  8 Pageschange in context of Emma and clueless shaped the values conveyed in the two texts? In Amy Heckerlings 1995 film clueless we see the deep transformation of Jane Austin’s more conservative 19th century classic Emma. In clueless we see the values and themes of high culture literature combined with the modern context of teenage society in the 20th century. The transformation of Jane Austens novel Emma to the 20th century film Clueless by Amy Heckerling allows for the same themes of social structure

Tuesday, December 10, 2019

Gandhi Essay Example For Students

Gandhi Essay 1-3-98Mike HenryGandhi also known as Mahatma Gandhi was born in Porbandar in the present stateof Gujarat on October 2, 1869 and got his education in law at University College inLondon. On 1891, after having been admitting to the British Bar, Gandhi returned toIndia and attempted to establish a law practice in Bombay, with little success. He wasappalled at the widespread denial of civil liberties and political rights to Indian immigrantsto South Africa. He threw himself into the struggle for elementary rights for Indians. Gandhi remained in South Africa for 20 years. He suffered imprisonment manytimes. During the Boar war, Gandhi organized an ambulance corps for the British armyand commanded a red cross unit. After the war he returned to his campaign for Indianrights. In 1914, the government of the Union of South Africa made important concessionsto Gandhis demands, including recognition of Indian marriages and abolition of the polltax for them. His work in South Africa complete, he returned to India. Following World War I, in which he played an active part in advocatingSalyagraha, launched his movement of passive resistance to Great Britain. Ademonstration against the Roulette Acts resulted in a massacre of Indians at Amritsar bythe British soldiers. In 1920, when the British government failed to make amends, Gandhiproclaimed an organized campaign of noncooperation. Indians in public office resigned,government agencies were boycotted, and Indian children were withdrawn fromgovernment schools. All through India, Indians were squatting on the streets blockingthem. The Indians who refused to leave were beaten by the police. Gandhi was arrested,but the British were soon forced to release him. India completely boycotted British goods. The exploitation of Indian villagers byBritish industrialists had resulted in poverty in the country and the virtual destruction ofIndian home industries. To remedy the poverty, Gandhi advocated the revival of cottageindustries. He began to use a spinning wheel as a token of the return to the simple villagelife he preached. Gandhi became the international symbol of free India. He lived a spiritual life,fasting and meditating. He refused earthly possessions, he wore the loincloth and shawl ofthe lowliest Indian and lived on vegetables, fruit juices and goats milk. Indians thought ofhim as a saint and began to call him Mahatma, meaning great soul. Gandhi was imprisoned off and on over the next several years. In 1930 heproclaimed a new campaign of civil disobedience, asking the Indian population to refuse topay taxes, particularly the tax on salt. He led a mar to the sea, in which thousands ofIndians followed him from Ahmadabad to the Arabian Sea. Once again, he was arrested. Gandhi fasted for long periods several times. His fasts were effective against the British,because revolution might well have broken out in India if he had died. In September1932, while in jail, Gandhi started a fast unto death to improve the status of the IndiaUntouchables. In 1934 Gandhi formally resigned from politics. A few years later, heagain returned. The Mahatma once again became the most important political figure inIndia. By 1944 the Indian struggle for independence was in its final stages. The Britishgovernment had agreed to independence on the condition that the two contendingnationalist groups, the Muslin League and the Congress Party should resolved theirdifferences. India and Pakistan became separate states when the British granted India itsindependence in 1947. During the riots that followed the partition of India, Gandhipleaded with Hindus and Muslims to live together peacefully. On January 13, 1948m 12 days after his last fast, he was on his way to his eveningprayer meeting when he was assassinated by Nathuram Godse, a Hindu fanatic. .u370ec21bac716e85606901f3d7eff5df , .u370ec21bac716e85606901f3d7eff5df .postImageUrl , .u370ec21bac716e85606901f3d7eff5df .centered-text-area { min-height: 80px; position: relative; } .u370ec21bac716e85606901f3d7eff5df , .u370ec21bac716e85606901f3d7eff5df:hover , .u370ec21bac716e85606901f3d7eff5df:visited , .u370ec21bac716e85606901f3d7eff5df:active { border:0!important; } .u370ec21bac716e85606901f3d7eff5df .clearfix:after { content: ""; display: table; clear: both; } .u370ec21bac716e85606901f3d7eff5df { display: block; transition: background-color 250ms; webkit-transition: background-color 250ms; width: 100%; opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #95A5A6; } .u370ec21bac716e85606901f3d7eff5df:active , .u370ec21bac716e85606901f3d7eff5df:hover { opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #2C3E50; } .u370ec21bac716e85606901f3d7eff5df .centered-text-area { width: 100%; position: relative ; } .u370ec21bac716e85606901f3d7eff5df .ctaText { border-bottom: 0 solid #fff; color: #2980B9; font-size: 16px; font-weight: bold; margin: 0; padding: 0; text-decoration: underline; } .u370ec21bac716e85606901f3d7eff5df .postTitle { color: #FFFFFF; font-size: 16px; font-weight: 600; margin: 0; padding: 0; width: 100%; } .u370ec21bac716e85606901f3d7eff5df .ctaButton { background-color: #7F8C8D!important; color: #2980B9; border: none; border-radius: 3px; box-shadow: none; font-size: 14px; font-weight: bold; line-height: 26px; moz-border-radius: 3px; text-align: center; text-decoration: none; text-shadow: none; width: 80px; min-height: 80px; background: url(https://artscolumbia.org/wp-content/plugins/intelly-related-posts/assets/images/simple-arrow.png)no-repeat; position: absolute; right: 0; top: 0; } .u370ec21bac716e85606901f3d7eff5df:hover .ctaButton { background-color: #34495E!important; } .u370ec21bac716e85606901f3d7eff5df .centered-text { display: table; height: 80px; padding-left : 18px; top: 0; } .u370ec21bac716e85606901f3d7eff5df .u370ec21bac716e85606901f3d7eff5df-content { display: table-cell; margin: 0; padding: 0; padding-right: 108px; position: relative; vertical-align: middle; width: 100%; } .u370ec21bac716e85606901f3d7eff5df:after { content: ""; display: block; clear: both; } READ: Child care vs parenting EssayGandhis death was regarded as an international catastrophe. His place inhumanity was measured in terms of history. A period of mourning was set aside in theUnited Nations General Assembly and condolences to India were expressed by allcountries. Religious violence soon waned in India and Pakistan and the teachings ofGandhi came to inspire nonviolent movements elsewhere.