Rna Extraction Cdna Synthesis And Real Time Pcr For...

RNA extraction, cDNA synthesis and real-time PCR for Smad3 gene Total RNA was extracted from frozen kidney tissues after processing using Qiagen RNeasy Total RNA isolation kit (Qiagen, Hiden, Germany) according to the protocol provided by the manufacturer, followed by synthesis of the first strand using SuperScript  ® III First-Strand Synthesis System for RT-PCR kit (Life Technologies) according to the manufacturer’s instructions. PCR reactions were performed using Power SYBR Green PCR Master Mix (Life Technologies) following the manufacturer’s instructions. Smad3 mRNA transcripts were quantified, relative to the housekeeping gene, glyceraldehyde-3-phosphatedehydrogenase (GAPDH) which was used as an internal control. Sequence specific primers were designed by Primer3 software: (http://bioinfo.ut.ee/primer3/) as follows: rat Smad3 forward primer (5 - AGGGCTTTGAGGCTGTCTACC-3 ) and reverse primer (5 - ACCCGATCCCTTTACTCCCA -3 ) (GenBank Accession No. NM_016769.4); rat GAPDH forward primer (5†²-GGTGAAGTTCGGAGTCAACGGA-3†²) and reverse primer (5†²-GAGGGATCTCGCTCCTGGAAGA-3†²) (GenBank Accession No. NM_017008). The final results were automatically calculated from the cross-point values of the target and the reference gene by Rotor-Gene Q 6plex and its specific software (Qiagen, Valencia, CA, USA). Statistical analysis Statistical analysis was conducted as mean and standard deviation using Statistical Package for Social Sciences (SPSS), version 16.0 for Windows (SPSS, Chicago, IL).Show MoreRelatedEnvironmental Pollutants, Drug And Ionizing Radiation Causes Inflammation And Oxidative Stress1951 Words   |  8 PagesSmad proteins act as primary mediators of inflammatory and fibrotic response [4].Carnosine (ÃŽ ²-alanyl-L-histidine) is a dipeptide with anti-ischemic, anti-oxidant, membrane stabilizing, heavy metal chelating activities, and reduces matrix proteins synthesis such as fibronectin, collagen of podocytes and mesangial cells [5,6]. Material and methods This research was carried out in accordance to the National Institutes of Health guidelines for the care and use of laboratory animals (NIH Publications

Theme of Transformation in Emma - 1209 Words

Emma also transforms into a proper woman through correcting her original neglect. Trollope states that â€Å"[i]n every passage of the book she is in fault for some folly, some vanity, some ignorance, or indeed for some meanness† (7)19. Because of her ignorance toward attitudes of her neighbors, Emma interferes through their lives in a way that makes them unhappy, for â€Å"she had often been negligent† (Austen 359)20. Mr. Knightley predicts the outcome of Emma’s plans in the beginning of the novel when he states that â€Å"[y]ou are more likely to have done harm to yourself, than good to them by interference† (Austen 8)21 and also that â€Å"[v]anity working on a weak head produces every sort of mischief† (Austen 53)22. Not only is Emma stubborn toward her†¦show more content†¦Eugene Goodheart views Emma’s imagination as a â€Å"bending predilection in the antithesis of the romantic sympathetic imagination†36 because Emma cho oses to live in a world that she creates around herself, such as the fantasy that she can marry Harriet Smith off to Mr. Elton. â€Å"She has come to realize to the full how her romantic attempts to marry Harriet such fantasies as to imagine Mr. Knightley in love with her; that the ideas of social hierarchy which Emma had fostered are fantasy† (Brooke)37. Emma’s immaturity only reforms when â€Å"Emma finds through her love of Mr. Knightley that much of her snobbery is false and superficial† (Brooke)38, and Emma is forced into the reality of the hierarchical Victorian society, where she â€Å"is instructed not only by Knightley but also by reality, which crushes her pride and forces her to abandon her delusional system† (Paris)39. Her misunderstandings of people are also seen in her obsessiveness, for â€Å"Emma’s ‘humors’ or obsessions are many, and they give rise to a variety of mistakes and illusions† (Paris)40. Her obsessive ness within her own fantasy leads her to attempting to find a husband for Harriet, which fails. When Emma finally realizes her mistakes, she is able to marry Knightley because â€Å"Emma has learned to balance power and propriety,† which reveals â€Å"Austen’s ideal of a lady as a woman who is strong but not manipulative† (Kohn)41. Another sign of Emma’s original misunderstandings of her society are clear in her judgment. â€Å"EmmaShow MoreRelatedEmma Clueless915 Words   |  4 PagesESSAY PLAN: TRANSFORMATIONS ( EMMA/CLUELESS Intro: C appropriates E’s 19th Century context into a contemp. Beverley Hill’s society embedded in material availability and conspicuous consumption. o Austen’s PURPOSE not changed ( C ( satire of context and human nature ( C has other purp. ( Question value and validity of texts ( POMO TRANSFORMATION THESIS: The transformation of a text helps develop and mold new meaning to its counterpart, and hence deepen the understanding ofRead MoreTransformations: Emma and Clueless1297 Words   |  6 PagesThe universality of themes pervading both Emma and Clueless in correlation with the humanistic, obviously flawed protagonists in both texts, captivates and immerses responders. This engagement leads to an involvement and enjoyment in the composer’s craft, which enables the responders’ to obtain sophisticated insight into the text’s concerns on both subjective and objective levels. Critiques agree that the transformation enables an audience to â€Å"enjoy cultural capital and aesthetic knowledge† whileRead MoreThe Connection Between Clueless and Emma Essay594 Words   |  3 PagesThe Connection Between Clueless and Emma A valuable connection can be made be made between Jane Austens Emma and Amy Heckerlings Clueless although fashion, customs, society and language differ between the two. The connection is made through the plot, characters and inevitable human nature. The themes of vanity, rank, status and gossip link the two medias and create a valuable linkage in relating the 19th century life with the contemporary world. Fashion is constantlyRead MoreAlice in Wonderland, A Different Approach to Organizational Change1717 Words   |  7 Pagesorganization. The case looks at how her own leadership characteristics contributed to the development of an authentizotic culture of trust, affiliation, and meaning for employees, and how the financial situation of the company was turned around as a result. Emma van Nijmegen is a rare example of a female top executive in a typically male dominated industry (Shipping and Transport). This case aims to show how LVVs remarkable turnaround from a loss making company in 1996 to a very profitable market-focused organizationRead MoreThe Transformation Of Social Structure, Values And Personal Relationships1471 Words   |  6 Pagesno part in the judgement of an individual’s character. But are our values really as developed as we believe? The transformation of Austen’s Emma to Clueless highlights the fixed nature of our social structure, values and person al relationships. Through this comparison it becomes evident that many of our current beliefs are not as dissimilar to Austen’s period as we may have thought. Emma depicts marriage as the focus of a women’s life with all achievements and skills of a woman being employed to furtherRead MoreJane Austen s Clueless 1280 Words   |  6 PagesAmy Heckerling’s film ‘Clueless’ enhances our understanding of the transformation derived from Jane Austen’s ‘Emma’ and communicates the issues of rigid social status and confined attitudes to women despite contextual realignments. By adapting the genteel society of Highbury to the superficial microcosm of Beverley Hills, we gain an understanding of the restricted values placed on social status and the objectivity of women. Both Austen’s and Heckerling’s satirical reflections on Regency EnglandRead MoreAnalysis of Themes Found in Emma1131 Words   |  4 PagesThe novel Emma is on e that is funny yet sweet and silly yet quite serious. These words may seem like antonyms to anyone else who has not read the novel but in essence they sum up what is Emma. Emma is a novel that is centered on a girl that is at times silly, vain, self-centered, superfluous, and overly confident yet there is a softer more vulnerable side to her that readers do not really fully grasp until the end of the book. Emma Woodhouse is a girl that says she will never get married yet sheRead MoreA Lesson Before Dying By Ernest J. Gaines926 Words   |  4 Pagesnovel, which kept me on the edge of my seat and had a hard time putting down. The novel explores various themes and concepts that surround the education system, filled with multiple emotional moments, conflicts, and surprising moments scattered throughout the storyline. However, the novel does not just focus on the education system and its underlying issues, but it also focuses on human transformation, where the emotional moments, confli cts, and surprising moments of the novel were most evident. AlthoughRead MoreEmma and Clueless Notes2482 Words   |  10 PagesEmma/Clueless speech Draft thesis: The ideas of appearance vs reality, development of maturity and love are ideas explored through techniques, Appearance vs reality -blindness to truth Emma | Clueless | * Manipulating reality to suit perception of it * Resulting self-deception, confusion, misunderstanding * Dramatic irony empowering us to see through human flaws and social failings of Emma. This often has unexpected results:-Mr Elton’s proposal â€Å"she could have been so deceived...sheRead MoreEmma and Clueless Essay1975 Words   |  8 Pageschange in context of Emma and clueless shaped the values conveyed in the two texts? In Amy Heckerlings 1995 film clueless we see the deep transformation of Jane Austin’s more conservative 19th century classic Emma. In clueless we see the values and themes of high culture literature combined with the modern context of teenage society in the 20th century. The transformation of Jane Austens novel Emma to the 20th century film Clueless by Amy Heckerling allows for the same themes of social structure

Gandhi Essay Example For Students

Gandhi Essay 1-3-98Mike HenryGandhi also known as Mahatma Gandhi was born in Porbandar in the present stateof Gujarat on October 2, 1869 and got his education in law at University College inLondon. On 1891, after having been admitting to the British Bar, Gandhi returned toIndia and attempted to establish a law practice in Bombay, with little success. He wasappalled at the widespread denial of civil liberties and political rights to Indian immigrantsto South Africa. He threw himself into the struggle for elementary rights for Indians. Gandhi remained in South Africa for 20 years. He suffered imprisonment manytimes. During the Boar war, Gandhi organized an ambulance corps for the British armyand commanded a red cross unit. After the war he returned to his campaign for Indianrights. In 1914, the government of the Union of South Africa made important concessionsto Gandhis demands, including recognition of Indian marriages and abolition of the polltax for them. His work in South Africa complete, he returned to India. Following World War I, in which he played an active part in advocatingSalyagraha, launched his movement of passive resistance to Great Britain. Ademonstration against the Roulette Acts resulted in a massacre of Indians at Amritsar bythe British soldiers. In 1920, when the British government failed to make amends, Gandhiproclaimed an organized campaign of noncooperation. Indians in public office resigned,government agencies were boycotted, and Indian children were withdrawn fromgovernment schools. All through India, Indians were squatting on the streets blockingthem. The Indians who refused to leave were beaten by the police. Gandhi was arrested,but the British were soon forced to release him. India completely boycotted British goods. The exploitation of Indian villagers byBritish industrialists had resulted in poverty in the country and the virtual destruction ofIndian home industries. To remedy the poverty, Gandhi advocated the revival of cottageindustries. He began to use a spinning wheel as a token of the return to the simple villagelife he preached. Gandhi became the international symbol of free India. He lived a spiritual life,fasting and meditating. He refused earthly possessions, he wore the loincloth and shawl ofthe lowliest Indian and lived on vegetables, fruit juices and goats milk. Indians thought ofhim as a saint and began to call him Mahatma, meaning great soul. Gandhi was imprisoned off and on over the next several years. In 1930 heproclaimed a new campaign of civil disobedience, asking the Indian population to refuse topay taxes, particularly the tax on salt. He led a mar to the sea, in which thousands ofIndians followed him from Ahmadabad to the Arabian Sea. Once again, he was arrested. Gandhi fasted for long periods several times. His fasts were effective against the British,because revolution might well have broken out in India if he had died. In September1932, while in jail, Gandhi started a fast unto death to improve the status of the IndiaUntouchables. In 1934 Gandhi formally resigned from politics. A few years later, heagain returned. The Mahatma once again became the most important political figure inIndia. By 1944 the Indian struggle for independence was in its final stages. The Britishgovernment had agreed to independence on the condition that the two contendingnationalist groups, the Muslin League and the Congress Party should resolved theirdifferences. India and Pakistan became separate states when the British granted India itsindependence in 1947. During the riots that followed the partition of India, Gandhipleaded with Hindus and Muslims to live together peacefully. On January 13, 1948m 12 days after his last fast, he was on his way to his eveningprayer meeting when he was assassinated by Nathuram Godse, a Hindu fanatic. .u370ec21bac716e85606901f3d7eff5df , .u370ec21bac716e85606901f3d7eff5df .postImageUrl , .u370ec21bac716e85606901f3d7eff5df .centered-text-area { min-height: 80px; position: relative; } .u370ec21bac716e85606901f3d7eff5df , .u370ec21bac716e85606901f3d7eff5df:hover , .u370ec21bac716e85606901f3d7eff5df:visited , .u370ec21bac716e85606901f3d7eff5df:active { border:0!important; } .u370ec21bac716e85606901f3d7eff5df .clearfix:after { content: ""; display: table; clear: both; } .u370ec21bac716e85606901f3d7eff5df { display: block; transition: background-color 250ms; webkit-transition: background-color 250ms; width: 100%; opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #95A5A6; } .u370ec21bac716e85606901f3d7eff5df:active , .u370ec21bac716e85606901f3d7eff5df:hover { opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #2C3E50; } .u370ec21bac716e85606901f3d7eff5df .centered-text-area { width: 100%; position: relative ; } .u370ec21bac716e85606901f3d7eff5df .ctaText { border-bottom: 0 solid #fff; color: #2980B9; font-size: 16px; font-weight: bold; margin: 0; padding: 0; text-decoration: underline; } .u370ec21bac716e85606901f3d7eff5df .postTitle { color: #FFFFFF; font-size: 16px; font-weight: 600; margin: 0; padding: 0; width: 100%; } .u370ec21bac716e85606901f3d7eff5df .ctaButton { background-color: #7F8C8D!important; color: #2980B9; border: none; border-radius: 3px; box-shadow: none; font-size: 14px; font-weight: bold; line-height: 26px; moz-border-radius: 3px; text-align: center; text-decoration: none; text-shadow: none; width: 80px; min-height: 80px; background: url(https://artscolumbia.org/wp-content/plugins/intelly-related-posts/assets/images/simple-arrow.png)no-repeat; position: absolute; right: 0; top: 0; } .u370ec21bac716e85606901f3d7eff5df:hover .ctaButton { background-color: #34495E!important; } .u370ec21bac716e85606901f3d7eff5df .centered-text { display: table; height: 80px; padding-left : 18px; top: 0; } .u370ec21bac716e85606901f3d7eff5df .u370ec21bac716e85606901f3d7eff5df-content { display: table-cell; margin: 0; padding: 0; padding-right: 108px; position: relative; vertical-align: middle; width: 100%; } .u370ec21bac716e85606901f3d7eff5df:after { content: ""; display: block; clear: both; } READ: Child care vs parenting EssayGandhis death was regarded as an international catastrophe. His place inhumanity was measured in terms of history. A period of mourning was set aside in theUnited Nations General Assembly and condolences to India were expressed by allcountries. Religious violence soon waned in India and Pakistan and the teachings ofGandhi came to inspire nonviolent movements elsewhere.

iPad case study MIS free essay sample

Who do you think are the winners and losers of the iPads success? Why ? †¢ iPad can be considered as a disruptive technology because it is achieving success in many fields , specially in media , so many users of normal ways of viewing media are transferring from those traditional ways and start using iPad , so iPad is destroying others popularity and success. The winners are the users and consumers because they are finding their comfort when using iPad , and the providers and suppliers of other industries are the losers as they lose their customers who transfer to iPad and leaving them.3- Describe the effects that the iPad is likely to have on the business models of Apple , content creators and distributers. †¢ Content creators in the past believed that the content is not as important as the device popularity but now , they totally understand that they need a high quality content from all types of media offered by their devices , on the other hand , the companys new goal af ter iPad is to make deals with each media industry to distribute contents at a price agreed to by the content owners and Apple. We will write a custom essay sample on iPad case study MIS or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page Mis in action : 1- iPad is powerful and useful in reading books because it allows you to highlight what you need and gives you the ability to take lots of notes. The iPad is clearly best at the latter two tasks, especially the note-taking. And it keeps getting better in that regard: Amazon recently updated its Kindle iOS app to offer several different colors of highlighter ink, making it easier to color-code your notes in a book as you go. That’s a feature shared by Apple’s iBooks app as well, as both companies work to appeal to the educational and textbook markets , it is powerful in surfing the web as it has the faster browser ever , it is also useful in watching video because of the large screen (10. 1 inch ) and because of the HD screen with millions of colors. The iPads shortcomings are : †¢The screen has too much glare The iPad has the same glossy screen as Apples Macbook Pro laptops and iMac desktops. Unless youre reading in a very dim room, the glare will be noticeable and can be distracting. Outdoors, even in the shade, the glare is really annoying. †¢Problems when reading in the sun If you thought to take your iPad along for an outing in Central Park or at the beach, forget about it. While bright and contrasty indoors, the iPads screen looks washed out and is almost impossible to view in bright sunlight. †¢Fingerprints are annoying Once youve used the iPad for a few minutes, among the most glaring shortcomings (besides the screen glare) are the fingerprints on the screen. With a smartphone, you can wipe the screen on your shirt or pants. The iPad is too big for that. Were wondering what exactly to clean it with and where well keep the cleaning supplies. 2- Comparison between iPad and Kindle tablets. Kindle is better and cheaper compared to IPAD when reading books especially when out in the sunlight. The glare is just impossible.the kindle paperwhite is just like reading a book and you can see the words clearly in sunlight. The Kindle Paperwhite boasts adjustable edge-lighting and a crisp, white E-ink display that enable comfortable reading in any environment. It also integrates with the best eBook store in the businessA Kindle owner can keep reference material, books for pleasure, business manuals and reading material for friends and family on a single device that fits easily into a backpack, briefcase or purse . E-books are available for purchase and download as gifts, and Kindle book gift cards can be purchased so that a recipient may make personal choices. Bookmarks, highlighting and search features are available on all versions of Kindles. The devices allows bookmarks and note-taking within the screen. When a user turns off a Kindle, the device remembers where the reader left off; when the user turns the Kindle back on, the book is restored to the last page the reader visited. Using a Kindle gives a user access to Kindle-only books, pamphlets andinformation. For example, author Stephen King wrote a novella specifically for the Kindle. Kindle also allows unencrypted forms of data to be stored on the device, such as . TXT files; Kindle 2 and newer versions allow . PDF files to be read.. 3- I would like to use traditional print publications because Ill be able to copy whatever I want to use later or to give it to friends , it also give me the ability to sketch and highlight on paper and I ca n write things easily on the pages.

Free Animal Testing Informative Essay

Free Animal Testing Informative Essay , animals will continue save our lives by theirs. Animal testing looks severe and leads to liberal killing of multiple innocent creatures, but it is inevitable evil. Animals lives in testing are that price we have to pay to be able to survive and save lives.

Rachel

Rachel Derek and WyattCharacter Overview:Derek:Derek is a man, who is very smart. He has a short temper and when he is angry you do not want to get in his way. He hates dumb burglars, and when a burglar messes up he turns them into the police. He hates having to kill people as his family were killed by burglars and he is only robbing banks so he can get enough money to give his Grandma heart surgery. He has been to prison once because Wyatt tried to shoot someone but missed and they were both caught. Derek has taken troubled Wyatt under his wing after meeting him in prison the first time.Wyatt:Wyatt is a man, who is not very smart. He is very flamboyant, and has a lot of patience. Wyatt is continuously making mistakes when he is under pressure. He loves killing people that he doesn't like.Before We Were Security GuardsHe only robs people because Derek does it. Wyatt loves to style things, in pink. He has Derek to cook, clean and make his bed for him, because Derek took him under his wing.Se curity Guards:Easy Targets, not very sneaky and large.Police:Smart, slim, fit, hate robbers and strong.SettingScene 1: They are in a bankScene 2: They are in a hideoutDerek and WyattScene 1: BankDerek sneaks on stageDerek: "The coast is clear Wyatt"(Derek calls for Wyatt to come with his hand)Wyatt sneaks towards Derek.Derek: "Did you check to make sure there were no security guards"Wyatt: "WhatI thought you were meant to!"Sirens sound and security guards come running.Derek: "You idiot Wyatt! You were meant to! The plan was for me to check if it was clear and you check for security guards!...

My Name is Seepeetza by Shirley Sterling Essay Example | Topics and Well Written Essays - 1750 words

My Name is Seepeetza by Shirley Sterling - Essay Example From this paper it is clear that the story actually offers a detailed insight into the residential school system, which existed during the time, but more importantly, it highlights the subversive strength of the protagonist to face and overcome challenging situations in life. As the essay highlights the author on a subtle note tries to provide the readers with an understanding of the issues and problems faced by her generation, but on the deeper side, she equips them with the power to face such situations and voice their thoughts without fear. The author’s ability to do so becomes evident from how a sixth grader overcomes situations of bullying, persecution, loneliness and terror. On the other hand, her positive attitude towards life becomes manifest when she demonstrates the capability to live another day with the sweet memories of her family. Literature also serves the purpose of providing readers with an opportunity to understand historical accounts through the perspective of different characters, the way they lived and the experiences in their lives. Seepeetza’s story is such an account, which offers the readers a detailed insight into the issues and hardships that an aboriginal girl faces in the residential school, and how she pulls thr ough all of it with her resolute willpower. She also firmly believes that no matter if her name, clothes and other things that remind her of her family are taken away, she still has her memories and deep rooted tradition that simply cannot be extricated from her. Sterling provides various instances starting from the beginning of the story, which showcases how Seepeetza fights back throughout her stay at the residential school and overcomes the oppressive authoritarian system as well as the racist evils of the school.

Exam on Religion Essay Example | Topics and Well Written Essays - 1000 words

Exam on Religion - Essay Example Because of this, the Young Earth Creationism Theory posits that the Earth is merely 6,000 years old. However, based on scientific findings, the Earth is 4.6 billion years old already. This puts it in a compromising stage, whereas the Day-Age Creationism can bridge both the scientific and religious data and that in fact, a single day (or yom in Hebrew) can mean an indefinite long period of time. This can be more accurate compared to the Young Earth Theory in a sense that a single day can be stretched into at least a thousand to a billion years, so theoretically, with six billion years allotted for creating the Earth, this is nearer that the actual age of the Earth. This means that the Day-Age Creationism is more feasible because there are also scientific results that support it. The Book of Revelations is seen as the go-to of apocalyptic literature. It states how Christ will return to the Earth, after chaos, war, pestilence, famine and persecution. It tells the story about the Wrath o f god, against all the false prophets and their followers, and all this suffering is overseen by God. He, in fact, released Satan and defeated him too (20:7-9) and later resided with the rest of humanity in New Jerusalem (21:2-8). This story is parallel to the Story of Job, albeit in a small scale. Job is also undertaken a series of tests to affirm his loyalty with the Lord. In fact, he was â€Å"sold out† to Satan to test his faith, although we know that in the end, Satan failed to corrupt him and the Lord even made Job richer and better than he ever was before (42:1-17).. The pattern is the same. Job can symbolize humanity and he has been punished, and was being prepped for the coming of the Lord. Humanity, in the Book of Revelations is also punished and was being prepped for the coming of the Lord and at the end of the punishment, the Lord replaced the Old Earth with a New Earth and there is no more suffering or death, and the curse ended (22: 6-21). Yes, I think the Book of Revelations is an expanded version of the Book of Job. 3. What are the implications and parallelisms of Ruth’s and Esther’s story in the Bible? The story of Ruth in the Bible is seemingly put there to explain David’s ancestry and nothing else. Esther’s story, on the other hand, merely recounts of the Festival of Purim came to be. The reasons for their places in the bible appear trivial but they are, in fact, not. Ruth, with her familial relations to King David, may as well be the New Abraham and Esther’s story of saving her people can make her the female counterpart of Moses. Abraham and Ruth, both ancestors of the great character in the Bible, even shared the same experiences like barrenness and famine (Abraham went down†¦ Gen 12:10 and There was famine in the land†¦ Ruth 1:2 ) and they traveled the same sojourn too. Esther’s story of saving her people was similar to that of Moses’ story too. Both were leaders or at leas t people of power and both are liberators of their people in a foreign place and they also kept their faith a secret at first. Even the festivals are parallel: The Passover celebrates the deliverance of Israel through the Passover while the Purim celebrates the Israelite’s survival on Haman’s pogrom. This implies that the Bible puts importance to women, and is, in fact, a gender-sensitive book, especially in this respect. 4. Use form criticism to analyze 2 Samuel 12:1-4. Form criticism attempts to trace a scripture from its early days in oral

Muhamad Abdel Wahab Essay Example for Free

Muhamad Abdel Wahab Essay Mohammad Abdel Wahab was born in 1907 and died in May 3, 1991. He was a prominent 20th century Egyptian singer and composer born in Bab El Shriyah area of Cairo Egypt. He composed 10 songs for Omm Katherm, the greatest Arab songstress in history. Mohammad Abdel is a legend to the vast majority of Arabic speaking people. Mohammad was a renown singer, composer and actor and who lasted in musical career for spanning seventy four (74) years. He had a captivating voice and his melodies were of the classical poetry from the Arab’s golden age and that of their modern struggle against Western colonialism. Through this composition he instilled in his listener a feeling of pride in their Arabic’s rich culture and heritage. Though Abdul Wahab is known for his music, he composed more that he sang. Exploring the life of Abdul Wahab as a composer without referring to his songs or music and acting is inadequate for all of were a part of him and his many released songs and movies that later became `hits` were as a result of his creativity and talented mind. His enjoyed musical voice and the melodies were no doubt a product of his great composition. His songs were his own compositions and it is said that from his teens Mohammad had composed for himself and other leading Arab singers over 1800 romantic and patriotic songs (Salloum. Habeeb). His composition had the Western taste due to his innovative nature of always thinking of new and better ways to enrich the traditional songs. This is a factor that has contributed to a great extent to the popularity and influence of his compositions among the youth, a reason that has made his compositions to maintain the lead in music industry up to date. In the 1920s Mohammad is said to have become a close friend of a well known poet, Ahmad Shawky who helped him excel well in compositions and boost his talent as a composer. In the following years the world watched Muhammad Abdul Waham climb the ladder to later become a star and earned himself the title ‘singer of princes’ When the Egyptian monarchy was overthrown in 1952 by young nationalist army officers his perception of life changed drastically and radically. His songs which were purely his own compositions became more inspiring and more patriotic. He produced some of his finest works which included ‘The Eternal Nile’, ‘Damascus’, Palestine the musical scores for Egypt’s national anthem and the national anthems of Oman and the United Arab Republic. He composed political, national and Arab national songs; Muhammad also composed more songs after 1933. His compositions underwent different stages of development due to the environment in which he lived. Muhammad as a person accepted the changes and that is why his music in great deals synthesized the two worlds (both Western world and Arab world). (Levinson. M. L, 1995) His music was at first traditional a thing that later changed to westernization after he underwent formal training in both Arabic and Western music. Among his early composition of song was the Goose Consul Operetta, based on a theme of Naguib El Rehani which became a great success. Later his movie composition introduced female artist such as Leila Murad a thing that may have been found awkward during the time. Muhamad Abdul Wahab in his own way was a revolutionary leader in some sort of special way. His compositions featured large orchestras with a Western blend of instruments such as the guitar bass, accordion and later the organ and synthesizer. He also added new rhythmic formulas, including the tango, the mambo, samba and rumba, as well as the Arabic oriental rhythms, maqsoum and baladi in his compositions. (The story behind the stomp) In the 1960s Abdul Wahab composed songs for other singers such Om Koulthom. He released Omri a recording that later became Egypt’s all time best seller. In the 1970s he started fading from the public though his music from his own compositions continued with the same energy and vigor but in 1988 when he was (81), he emerged again to the surprise of many with new composition of his own. Age to him was nothing, infact it gave him more reason to write and consequently more reason to live. In his life time Abdul Wahab was recognized for his work in his great compositions, music and movie industries and hence received a lot of awards. Suprisingly enough his work is still rated as one of the best to have ever come from an Arab world. (Levinson. M. L) He died at the age of ninety and Egypt country honored him with a huge military funeral at the Rabia-al-Aldawiya Mosque in Cairo. After his death, his work was covered in newspapers, radio and television ranging from his compositions of songs and movies. He was accorded the title `The father of modern Arabic songs`. He died in 1991 of heart failure; he left a legacy nobody can afford to forget especially in the world of modern Arabic music and melody. Up to until his death Mohammad sorts peace in his writings, writings that appealed to both the old and the young. He stole many hearts with his music and compositions and became a beloved figure. Although he is gone he speaks to us through his work Works Ci

Grace And Sin :: essays research papers

Grace In order to completely understand the theology of grace you have to take a look at Augustine, Aquinas, Luther, Rahner, Segundo, and Boff, and how they understood what grace was. Their theories on grace have some valid points and yet they also have some invalid points. Augustine took a personal approach to grace and he believed in the massa damnata, which basically means that on the whole people are damned. He said before the original sin, you had a choice to be good or evil. Also, Augustine said that there is a double predestination, which means only some people are chosen before they are born if they are going to go to heaven. I don’t agree with this because it is basically saying that there is no salvation for all people. Aquinas thought that grace was added to nature and it elevates nature. He wrote the Summa, which demonstrates the beatific vision. The beatific vision is when the mind is unified to God. Aquinas’ theology is dualistic which displays natural and supernatural as separate entities. I don’t believe in his beatific vision because I believe that God allows us to make our own choices out of free will so our mind cannot be unified with Him. Unless I am wrong, this is saying God knows what is going to happen before it happens. If this is the case why do we have suffering; because God gave us free will. Luther viewed grace through his own view of himself as a sinner. He was so obsessed that he confessed his sins seven times a day. He said that grace is a favor of God and it heals a person’s sinfulness. He said that Jesus’ word was a vehicle of grace and that grace cannot be merited. I think his views on grace are not very good only because he views God as an active member and humans as a passive one. In order to be truly graced I believe that both parties need to be active and involved. Rahner believes that grace is intrinsic to nature and he also believes in Anonymous Christianity. This theory is that every person on this Earth is a Christian even if you do not know it. I don’t agree with this theory because, once again God gives everyone free will and this allows people to believe the way they want to. Boff says grace is a relationship with the trinity. I agree with this because it consists of showing love and devotion to all three persons of our one God. He also said that liberation is the key to grace. I some what agree with

Every dark cloud has a silver lining.

Dialogue between the Bank Manager and a client about opening an account. Client: Sir, Excuse me. May I come in? B. Manager: Yes you may come in. Client: I am Miss. Mary and I come from Oakmont. Manager: What can do for you? Sir, I would like to open an account in your Bank. Manager: May I know your profession? Sir, I working as secondary Grade Teacher in Oakmont High School at Superman Manager: Why do you want to open an account in the state Bank of India? Client: Sir, I have Just Joined my duty in the school last week.It's a mandatory or the teachers to have an account opened in the state Bank of India, because the salary is paid through the banks. Manager: Well, then please fill up the application form to open an account in your name. Client: Yes, Sir. Can I get the application form? Manager: Yes, you can collect from the next desk. Prior to It please produce the following document: 1. Your ID proof 2. Residential proof 3. Pan Card 4. Ration card 5. Age proof etc†¦ Client: Sir , excuse me right now I do not have all the documents. Can I come tomorrow, sir?Manager: Yes, It Is better that if come with all the comments tomorrow it would be very easy to fill up the form. Client: Sir, should I take the application form and go? Manager: Yes, it would be better so that tomorrow the work will go faster. (The client goes near the gate, as he reaches the gate the manager calls her back) Manager: Hello, Miss. Mary. Client: Yes, Sir. Manager: Something which Is very Important that I have forgotten. Client: What Is it SST Manager: It Is regarding the witness. Client: What It means by witness?Manager: Witness means that the person one who has the bank account In our Ann. Has to Introduce you to the bank. Client: Is It compulsory, Sir. Manager: Yes, It Is mandatory. Otherwise you will not be able open an account. Client: Thank you very much, Sir. I am very much pleased with you for Glenn me all the Information needed to open an account In your bank. Manager: k. Thank yo u. Client: Thank you so much, Sir. I shall come with a witness and with all the documents tomorrow. Every dark cloud has a silver lining. By monogamy 23 Manager: Yes, you can collect from the next desk. Prior to it please produce the Can I come tomorrow, sir?Manager: Yes, it is better that if come with all the Manager: Something which is very important that I have forgotten. Client: What is it Sir? Manager: It is regarding the witness. Client: What it means by witness? Manager: Witness means that the person one who has the bank account in our bank has to introduce you to the bank. Client: Is it compulsory, Sir. Manager: Yes, It is mandatory. Otherwise you will not be able open an account. Client: Thank you very much, Sir. I am very much pleased with you for giving me all the information needed to open an account in your bank. Manager: k. Thank you.

Sherlock Holmes Essay

â€Å"The resemblance to a fierce old bird of prey† shows just how frightening this character is. Using this descriptive language is important as it portrays Dr Roylott as someone who is overpowering, fierce and evil which makes him sound like a frightening person who would commit murder. This also creates tension in the reader making them want to find out if it is him who is the murderer. 5. What did you hope to achieve through creating the character Sherlock Holmes? Through the character of Sherlock Holmes I hoped to show him as a positive role model and someone who the law should be like. In those days the police’s â€Å"attempts to combat crime shifted back towards the prevention of crime, as opposed to the detection of criminals. † (This source is from www. oldbaileyonline. org/history/crime/policing. html#metrotext) This is why the police dismissed Helen Stoners story and if Sherlock Holmes had done the same thing then Helen Stoner would have died. This shows how the way of policing was back then. I hoped to change the police force through the character of Sherlock Holmes to make them realise that policing had to be aimed at the detection of criminals as well as preventing crime. â€Å"Pray be precise to details† shows that Holmes is interested and wanting to find out why Julia Stoner died, unlike the police force who just wanted to prevent than solve crime. 6. How did you create a sense of mystery and tension in the plot of ‘The Speckled Band? ‘ I created the sense of tension and mystery in the story by showing evidence along the way. â€Å"Why it’s a dummy† â€Å"A ventilator into another room† There were several little changes carried out about that time† â€Å"A small saucer of milk† â€Å"A small dog leash. † All this evidence adds to the tension and making the reader want to read on to find out how the evidence is all linked. Also, â€Å"How shall I ever forget that dreadful vigil? † This rhetorical question shows how terrible the ordeal was. â€Å"I could not here a sound, not even the drawing of a breath†¦. The shutter cut off the least ray of light and we waited absolute darkness. † This quote makes the reader feel like they are waiting for something to happen and therefore, thus building more tension. 7. How important was setting in the story ‘The Speckled Band? The setting in ‘The Speckled Band’ such as â€Å"the building of grey† was important because it symbolises the danger that lurks about them. â€Å"Lichen-blotched stone, with a high central portion and two curved wings like the claws of a crab. † The simile which describes . Stoke Moran shows the danger that Holmes and Helen are in. The claws sound like they are dangerous and will trap anyone and make them suffer a terrible fate for those who approach them. â€Å"It was a perfect day, with a bright sun and a few fleecy clouds in the heavens. The trees and wayside hedges were just throwing out their first green shoots, and there was full of the pleasant smell of the moist earth†¦ and this sinister quest upon which we were engaged. † This pathetic fallacy shows the contrast between where they are coming from which is calm and â€Å"pleasant† and Stoke Moran, which is portrayed as a â€Å"sinister† place full of danger and mystery. This setting is important as it also builds tension in the reader which makes them want to read on. Sam Booth 10/05/2007 1 of 3 Show preview only The above preview is unformatted text This student written piece of work is one of many that can be found in our GCSE Arthur Conan Doyle section.

Database Management Systems in Charities

Database Management Systems in Charities Introduction Background information The modern world has become smaller and people are becoming more responsible. This trend is manifested through appearance of numerous non-profit organisations that help underprivileged people or simply people in need. At the same time, not-for-profit organisations often fail to achieve their goals and operate ineffectively due to the use of inefficient database management systems.Advertising We will write a custom proposal sample on Database Management Systems in Charities specifically for you for only $16.05 $11/page Learn More Modern organisations have to handle significant amount of information including data on operations, accounting, human resources, customer support and so on. It is noteworthy that churches are now seen as organisations that also need proper information management (Carlson Lueken 2013; Hegstad 2013). Clearly, numerous database management systems have been utilised by for-profit companies and there a re quite many efficient systems. However, not all of them can be used by charities. For instance, these organisations need specific software for such operations as donation management. Notably, IT companies provide numerous products to meet these organisations’ needs (Kensington Temple manages donations n.d.; Church management software 2014). IT companies are developing database management systems for nonprofit organisations that address other issues as well. It is possible to identify most widespread systems employed by charities. Top three systems are Blackbaud, Network for Good and FirstGiving (Top non-profit software 2014). It is noteworthy that 81% of reporting non-profit organisations accept online donations and this increases the need in a comprehensive and reliable data management system (2014 state of the not-for-profit industry 2014). UK nonprofit organisations as well as churches have already acknowledged benefits of the use of efficient database management systems and utilisation of such a system is seen as an advantage and a sign of effectiveness as well as transparency of the organisation (The Methodist Church in Britain 2014).Advertising Looking for proposal on business economics? Let's see if we can help you! Get your first paper with 15% OFF Learn More There are numerous guidelines on the use of these systems for charities and churches (Kuschewsky 2014; Protecting data, protecting people 2013; Keep or bin? 2009). This also suggests that increased attention towards the issue exists in the society and among non-profit organisations. Purpose of the Study This research aims at identifying major issues not-for-profit organisations and churches in UK face when using database management systems and effective solutions to handle the problems. The research will cover such major areas as donations management, volunteer management, HR management, safety, transparency and compliance with standards. Such issue as employee tr aining will also be touched upon. The present study will explore latest advances in this field through analysis of resources available on the matter. It is also important to understand how charities’ employees see database management systems. It is necessary to learn whether they find these systems helpful, efficient and easy to use. Furthermore, it is important to understand whether employees can utilise the systems and whether there is sufficient training. Finally, the study will also cover strategies used by employees to handle issues they face while using data management systems. All this information will provide insights into advantages and shortcomings of database management systems used and will help outline areas of improvement. Literature Review Researchers stress that effective information management enables companies to remain competitive (Botten 2007; Light 2004). When it comes to charities, these organisations often face more issues as some of tools employed by f or-profit companies is inapplicable. Hackler and Saxton (2007) explore issues non-profit organisations face by analysing literature existing on the matter and they conclude that charities have to enhance their capacities in such spheres of IT planning as budgeting, support, staffing, Internet capabilities, training and so on. Researchers stress that charities have to invest into efficient database management systems to be able to manage information effectively (Campbell 2009; Dutton 2013). Poister (2008) believes that performance of non-profit organisations depends on the choice of the database management system (which also has to be assessed in terms of its performance).Advertising We will write a custom proposal sample on Database Management Systems in Charities specifically for you for only $16.05 $11/page Learn More Not-for-profit organisations tend to utilise systems employed by other (for-profit) companies as well as systems developed for charities. C alabrese (2011) provides a brief account of existing database management systems that are often used in not-for-profit organisations. It has been acknowledged that some database systems are not appropriate for charities (The non-profit marketplace 2008). Thus, Voida, Harmon and Al-Ani (2011) focus on challenges non-profit organisations face when it comes to volunteer management and coordination. It has been acknowledged that churches are also organisations that need effective information management and specific needs of these organisations have been addressed (Cappel 2002; Wrenn 2013). Pynes (2009) reveals peculiarities of human resources management in organisations (including charities) and provides helpful insights into the use of database management systems addressing this part of any organisation’s operations. It is noteworthy that there is significant bulk of literature on different types of database management system. For instance, Buttle (2008) provides a detailed acco unt of different types of database management systems that can be used in numerous settings. It is noteworthy that researchers focus on flexibility that is important for charities. For instance, Kumar et al. (2012) develop a system that is flexible and able to address the needs of a charity organisation. DeBrabant et al. (2013) introduce a new approach to database management systems and a new architecture. Clearly, data safety is another concern of any organisation and charities are no exception. Thus, all stakeholders (non-profits’ employees, donators, and so on) have to be protected and this is one of central factors to pay attention to when choosing the right database management system (Parsons Oja 2008; Hingarh Ahmed 2013; Stair Reynolds 2013). Hasan (2009) reveals effective solutions for protecting data in regulatory-compliant and provenance databases.Advertising Looking for proposal on business economics? Let's see if we can help you! Get your first paper with 15% OFF Learn More Apart from this, researchers note that there is need in transparency and efficient database management systems can enable charities and churches address this need (Study on recent public and self-regulatory initiative 2009; Chasteen Lampkin 2012). Hence, Behn, DeVries and Lin (2010) research determinants of transparency in charities and note that the organisation’s size, contribution ratio and compensation expense ratio are factors that affect charities’ readiness to share information. Brody (2012) stresses that donators, officials, volunteers and the rest of the society expect more transparency on the part of non-profit organisations. Another important issue addressed by researchers is these organisations’ compliance with certain standards. Sloan (2008) stresses that these organisations’ compliance with standards is meaningful for donators and it may shape the way donators see nonprofits. Moutchnik (2008) analyses the recent trend associated with the us e of ISO standards by churches and argues that it enhances these organisations’ accountability. Methodology Qualitative Method As has been mentioned above, the purpose of this research is to identify issues related to the use of database management systems non-profit organisations face and ways they try to handle the problems. Therefore, it is important to identify systems used, problems that occur, strategies employed to handle the issues and success stories. Neergaard and Ulhoi (2007) note that it is beneficial to use combined research methods in entrepreneurship. The present paper will be based on qualitative research method. Alvesson and Skoldberg (2009) note that phenomenological approach can be used to determine existing knowledge on a phenomenon. Since the present study aims at identifying certain phenomenon, it is possible to use this approach. The phenomenological research implies analysis of existing literature on certain phenomenon and developing ties between the e xisting literature and particular processes taking place in the society. Data collection and analysis: literature analysis Therefore, the present study will involve analysis of literature available on the matter and a survey including a number of interviews. Literature review will include analysis of articles from peer reviewed journals, books, newspaper articles. Websites and reports of certain charities will also be examined. These reports will help determine attention paid by the organisation to the data management system (The church of Scotland 2013; Charitylog 2013). Forty resources will be included in the analysis. Grounded theory will be used to analyse the literature available. Maxwell (2012) stresses that this is the most appropriate approach for literature analysis as it enables to explain and extend the scope of the field. Major areas of concern will be identified. As has been mentioned above specific attention will be paid to donations, human resources, volunteer managem ent, data protection and transparency. This analysis will affect development of questionnaires for the survey and interviews. Major concerns revealed in the literature will be included in the questionnaires. Data collection and analysis: survey and interviews The survey will be held with the help of the Internet. Questionnaires developed on the basis of the literature analysis will be sent via emails to employees of noprofit organisations (including local churches). Participants will be managers (of different levels) working in charity organisations for more than a month. They will be selected randomly. Prior to this heads of non-profit organisations will be addressed to obtain their consent. Since this is a qualitative research, major attention will be paid to participants answers though the questionnaires will include participants’ personal data (which can be used for further research) It is planned to process around forty questionnaires containing questions on database man agement systems used, issues occurring and approaches to handle problems. The questionnaires will include close as well as open questions and participants will be able to provide detailed answers. Grounded theory will be employed to analyse questionnaires as well as data obtained during the interviews. Again, major attention will be paid to areas mentioned above. At that, specific attention will be paid to strategies employees exploit to handle issues that occur. The questionnaire will include 25 questions and participants will be given sufficient time to complete them. They will send completed questionnaires via email. The final stage of the research will include interviews with ten managers. The interviewees will be chosen based on the answers in their questionnaires. Apart from revealing issues employees face, the research aims at identifying effective solutions used to address these issues. Therefore, the most effective (or unusual strategies) reported by employees in their ques tionnaires will get most attention. Participants generating such solutions will be invited to the interview. The interviews will be held in quasi-relaxed setting: either in the workplace (for example, meeting room) or in the park. The interviews will be recorded. The questions asked at the interview will be developed on the basis of the survey results. The major aim of the interviews is to elicit interviewees’ attitude towards database management system and the way they handle issues. Grounded theory will be used to analyse the data collected during the interviews. Clearly, written consent will be obtained from all participants who will be notified about the purpose of the research. Conclusion In conclusion, the research will identify issues associated with the use of database management systems in charities as well as churches and effective ways to handle these problems. The study is based on qualitative research method and the data obtained will help elicit employeesâ€℠¢ attitude towards the use of a data management system. Apart from qualitative analysis of data, some recommendations to managers of not-for-profit organisations will be provided. This study will expand the scope of knowledge on the matter. It will also reveal issues existing in the field. Admittedly, the present research has a number of limitations. For instance, the number of participants is quite limited. More so, organisations and churches located in the UK are researched. Hence, the study will be limited geographically. Though the research may be statistically insignificant, it will unveil major issues existing in the field. It is possible to assume that the present study is the first step in the process of identification of issues associated with the use of database management systems. Further research may cover larger territories and more participants. Reference List 2014 state of the not-for-profit industry: survey summary report 2014, https://www.blackbaud.co.uk/files/bbe/S ONI/SONI_UKReport2014.pdf?mkt_tok=3RkMMJWWfF9wsRomrfCcI63Em2iQPJWpsrB0B%2FDC18kX3RUmJL2Zfkz6htBZF5s8TM3DUVdDXr1Z6kEJSbE%3D. Alvesson, M Skoldberg, K 2009, Reflexive methodology: new vistas for qualitative research, SAGE, London. Behn, BK, DeVries, DD Lin, J 2010, The determinants of transparency in non-profit organisations: an exploratory study, Advances in Accounting, Incorporating Advances in International Accounting, vol. 1, no. 1, pp. 6-12. Botten, N 2007, CIMA official learning system management accounting business strategy, Butterworth-Heinemann, Burlington, MA. Brody, E 2012, Sunshine and shadows on charity governance: public disclosure as a regulatory tool, Florida Tax Review, vol. 12, no. 4, pp. 175-206. Buttle, F 2008, Customer relationship management: concepts and technologies, Routledge, Oxford. Carlson, K Lueken, M 2013, Renovation of the church: what happens when a seeker church discovers spiritual formation, InterVarsity Press, Downers Grove, IL. Calabrese, T 2011, Running on empty: the operating reserves of US non-profit organisations, baruch.cuny.edu/spa/centers-and-institutes/center-for-nonprofit-strategy-and-management/documents/Calabrese_RunningonEmpty-TheOperatingReservesofUSNonprofitOrganizations.pdf. Campbell, P 2006, How to decide: IT planning and prioritizing, in H Ross, K Verclass A Levine (eds), Managing technology to meet your mission: a strategic guide for non-profit leaders, John Wiley Sons, San Francisco, CA, pp. 79-101. Cappel, JJ 2002, A systems analysis and design case: ABC church, Journal of Information Systems Education, vol. 12, no. 4, pp. 233-243. Charitylog 2013, charitylog.co.uk/wp-content/uploads/2012/10/Brochure-2013-v2.3.pdf. Chasteen, CS Lampkin, LM 2012, Improved transperancy for charity executive pay: a review of form 990 data, erieri.com/pdf/CharityExecutivePay.pdf. Church management software 2014, activenetwork.com/church-management-software . DeBrabant, J, Pavlo, A, Tu, S, Stonebraker, M Zdonik, S 2013, Anti-caching: a new approach to database management system architecture, Proceedings of the VLDB Endowment, vol. 6, no. 14, pp. 1942-1953. Dutton, WH 2013, The Oxford handbook of Internet studies, Oxford University Press, Oxford. Hackler, D Saxton, GD 2007, ‘The strategic use of information technology by nonprofit organizations: increasing capacity and untapped potential’, Public Administration Review, vol. 67, no. 3, pp. 474-487. Hasan, R 2009, Protecting the past and present data, with applications in provenance and regulatory-compliant databases, http://wcms.inf.ed.ac.uk/idar09/papers-and-abstracts/idar09-submission-4.pdf. Hegstad, H 2013, The real church: an ecclesiology of the visible, Casemate Publishers, Cambridge, UK. Hingarh, V Ahmed, A 2013, Understanding and conducting information systems auditing + websites, John Wiley Sons, Hoboken, NJ. Keep or bin? The care of your parish records 2009, lambethpalacelibrary.org/files/Parish_Records_0.pdf. Kensington Temp le manages donations more efficiently with DK software n.d., dk-bs.co.uk/Portals/8/PDFs/dkSoftware-KT-case%20study-2.pdf. Kumar, BK, Prasad, SD, Manohar, PM, Prakash, KVVSS, Chiranjeevi, M Kiran, KV 2012, Database management system and information retrival, International Journal of Computer Science and Information Technologies, vol. 3, no. 2, pp. 3632-3637. Kuschewsky, M 2014, Big data analysis is possible without infringing key privacy principles, says international working group, The National Law Review, natlawreview.com/article/big-data-analysis-possible-without-infringing-key-privacy-principles-says-internatio. Light, PC 2004, Sustaining non-profit performance: the case for capacity building and the evidence to support it, Brookings Institution Press, Washington, DC. Maxwell, JA 2012, Qualitative research design: an interactive approach, SAGE, London. Moutchnik, A 2008, Churches embrace ISO management system standards, ISO Management Systems, pp. 1-19. Neergaard, H Ulhoi, JP 2 007, Handbook of qualitative research methods in entrepreneurship, Edward Elgar Publishing, Northampton, MA. Parsons, JJ Oja, D 2008, New perspectives on computer concepts 2010: comprehensive, Cengage Learning, Boston, MA. Poister, TH 2008, Measuring performance in public and non-profit organisations, John Wiley Sons, San Francisco, CA. Protecting data, protecting people: a guide for charities 2013, cfg.org.uk/resources/Publications/~/media/Files/Resources/CFDG%20Publications/Data_Protection2013.ashx. Pynes, JE 2009, Human resources management: for public and non-profit organisations, John Wiley Sons, San Francisco, CA. Sloan, MF 2008, The effects of non-profit accountability ratings on donor behaviour, Nonprofit and Voluntary Sector Quarterly, vol. 20, no. 10, pp. 1-17. Stair, R Reynolds, G 2013, Principles of information systems, Cengage Learning, Boston, MA. Study on recent public and self-regulatory initiatives improving transparency and accountability of non-profit organis ations in the European Union 2009, http://ec.europa.eu/dgs/home-affairs/doc_centre/terrorism/docs/initiatives_improving_transparency_accountability_npos_avr09.pdf. The church of Scotland 2013, churchofscotland.org.uk/__data/assets/pdf_file/0019/14419/unincorporated_report_and_accounts.pdf. The Methodist Church in Britain 2014, theaccessgroup.com/media/2166838/methodistcs.pdf. The non-profit marketplace bridging the information gap 2008, hewlett.org/uploads/files/whitepaper.pdf. Top non-profit software 2014, capterra.com/fundraising-software/#infographic. Voida, A, Harmon, E Al-Ani, B 2011, Homebrew databases: complexities of everyday information management in non-profit organisations, CHI, http://ellieharmon.com/docs/VoidaHarmonAlAni-Homebrew-CHI2011.pdf. Wrenn, T 2013, Innovative planning: your church in 4-D, Chalice Press, Danvers, MA.

How Verbs Become Adjectives

How Verbs Become Adjectives How Verbs Become Adjectives How Verbs Become Adjectives By Mark Nichol What determines whether a verb-to-adjective transformation ends with the suffix -able (as in assessable) or with -ible (as in accessible)? Why do some root words accept both options? What happens if the word ends with an e? Answers to these and other questions about -able and -ible follow. The suffixes -able and -ible both express capability, fitness, or worth (or mean â€Å"tending, given, or liable to†), but there’s one key practical difference: The former flourishes, and the latter has fossilized. New words can be formed by attaching -able to an adjective (I’ll get back to that in a moment) or a noun (more about that later, too) but -ible, though widespread in existing words, is discouraged for new coinages. Some words use one form unequivocally. (For example, immovable and invincible are never rendered immovible and invincable). Others are spelled either way, although one form predominates (as in the case of discernible and its less frequent variant discernable). In some cases, the variants reflect a distinction of meaning: For example, collectable means â€Å"able to be collected,† but the more common collectible has the connotation of desirability and is used as a noun to denote something worth collecting. Intransitive verbs can also be transformed into adjectives by appending -able. Strictly speaking, reliable, for example, means â€Å"able to be relied on,† not just â€Å"able to be relied,† but the needs of the language have silenced opposition to such usage. Adjectives are also formed from attaching -able to nouns, such as objectionable from objection, though the nonword objectable is the logical formation based on the verb-plus-able formula. Two other peculiarities exist regarding the suffix: When it is appended to a verb ending in -ate, such as calculate, the original suffix is omitted, resulting, for example, in calculable (which is overshadowed in frequency of usage by its antonym, incalculable). And when a word ends in e, such as in the case of move, the e is omitted when -able is attached, hence movable. (You’ll see moveable and the like in older publications, but this form is rare in contemporary usage.) Exceptions occur when a soft c or a soft g precedes the e, as in serviceable and changeable. When coining new terms, keep these rules in mind though consider, as well, that even some existing words, such as embraceable, are ungainly, and newly minted terms may be disagreeable to some readers. Want to improve your English in five minutes a day? Get a subscription and start receiving our writing tips and exercises daily! Keep learning! Browse the Spelling category, check our popular posts, or choose a related post below:12 Greek Words You Should KnowRunning Amok or Running Amuck?Ebook, eBook, ebook or e-book?

Computers in architecture- Mercedes-Benz Museum in Germany Assignment

Computers in architecture- Mercedes-Benz Museum in Germany - Assignment Example It is based on the geometrical shape of a clover in which spaces are connected through two ascending ramps. The exterior design of Mercedes Benz Museum sets up a completely novel and astonishing typology by the acquisition of spatial principles. This novelty is solely attributed to the digital design of this building in which the perfect infusion of ratios between space and design has been considered (Szalapaj). This building was designed in a three dimensional data which was revised numerous times during its realization in Stuttgart. The utilization of three dimensional digital designs and its effectiveness is also represented in the use of glass in the exterior design of this building. A special kind of glass has been utilized in this building which is clear, transparent and does not gets affected by the sunlight regarding heat (Noden). These glasses are divided and placed in several panels which, in combination, present the impression of the building as a double dimensional facade . This feature is also based on the scientific principles of light and geometry which is sufficiently presented in the design of this building, increasing its creativity and aesthetics (Glasner and Schmidt). The whole exterior design of Mercedes Benz Museum is a correspondence to the modern technology in which digital art, especially of three dimensions, in a remarkable manner. From the color of the building to the shape and from the utility of glass to the connections of spaces, this building is a complete representation of digital design into practical form (Turnbull). Interior: As far as the interior design of Mercedes Benz Museum is concerned, the ramps bridging spaces from... Over the past few years computers have become a necessary tool in the field of architecture. Architects all around the globe are using digital tools to make their creative thoughts into a reality (Bermudez). Digital technology allows architects to form models and create prototypes without having to use or waste any physical material. Moreover, latest architectural digital tools allow architects to view these models in three dimensions and from all sides. With the help of these tools architects have been able to create buildings that comprise of a complex structure (Bermudez). One such building is the Mercedes-Benz Museum in Stuttgart. The building was designed by a number of architects from UNStudio. In their book Ben Van Berkel and Caroline Bos, founders of UNStudio, stated that the creation of the building made use of a number of expertise and that it was a joint effort by architects of the entire studio (Berkel and Bos). UNStudio was founded in 1988 in Amsterdam and specializes in the fields of architecture infrastructural programs and urban development. UNStudio stands for United Network Studio (UNStudio). UNStudio is one of the most popular architectural firms in Europe and Asia. The company has been accredited with designing innovative structures such as the Star Place Luxury Shopping Plaza, Erasmus Bridge and The Burnham Pavillions. In the completion of these structures computers and digital tools have played a major role. The same can be said about Mercedes Benz Museum. Every aspect of the building’s structure sheds light on how digital tools were used to design the building as a whole.

Should Everyone be Equal in the Society Essay Example | Topics and Well Written Essays - 250 words

Should Everyone be Equal in the Society - Essay Example At only 14 years old, Harrison Bergeron tries to break down the equality that has engulfed the entire country including his father. Handicapper general ensures that she monitors any bright person who tries to think beyond the normal reasoning capacity. Individuality in this society is no more. This is evident when the handicapper general guns down Harrison Bergeron and her empress. Hidden individuality is also evident when the presenter who reads the press conference does the reading while wearing a mask since she is pretty. Because Harrison is more handsome and stronger, he gets to carry the heaviest load of handicaps to weaken him. The tone of the story varies from fearful to happiness but ends up in a somber mood when main characters end up dead. Happy mood is evident when Harrison frees everyone in the studio from the slavery of wearing handicaps and dancing sets in.

The story of Jack the Ripper Research Paper Example | Topics and Well Written Essays - 2000 words

The story of Jack the Ripper - Research Paper Example Over the years the mystery has deepened to the degree that the truth is almost totally obscured. Innumerable press stories, pamphlets, books, plays, films, and even musicals have dramatized and distorted the facts to such a degree that the fiction is publicly accepted more than the reality. Suffice to say genuine suspects are far fewer than the prolific authors of the genre would have us believe. In fact, to reduce them to only those with a genuine claim having been nominated by contemporary police officers, we are left with a mere four. They are: Dr. Francis J. Tumblety, 56 Years old, an American 'quack' doctor, who was arrested in November 1888 for offenses of gross indecency, and fled the country later the same month, having obtained bail at a very high price. The first three of these suspects were nominated by Sir Melville Macnaghten, who joined the Metropolitan Police as Assistant Chief Constable, second in command of the Criminal Investigation Department (C.I.D.) at Scotland Yard in June 1889. They were named in a report dated 23 February 1894, although there is no evidence of contemporary police suspicion against the three at the time of the murders. Indeed, Macnaghten's report contains several odd factual errors. Kosminski was certainly favored by the head of the C.I.D. Dr. ... Dr. Robert Anderson, and the officer in charge of the case, Chief Inspector Donald Swanson. Druitt appears to have been Macnaghten's preferred candidate, whilst the fact that Ostrog was arrested and incarcerated before the report was compiled leaves the historian puzzling why he was included as a viable suspect in the first place. The fourth suspect, Tumblety, was stated to have been "amongst the suspects" at the time of the murders and "to my mind a very likely one," by the ex-head of the Special Branch at Scotland Yard in 1888, ex-Detective Chief Inspector John George Littlechild. He confided his thoughts in a letter dated 23 September 1913, to the criminological journalist and author George R Sims. For a list of viable suspects, they have not inspired any uniform confidence in the minds of those well-versed in the case. Indeed, arguments can be made against all of them being the culprit, and no hard evidence exists against any of them. What is obvious is the fact that the police were at no stage in a position to prove a case against anyone, and it is highly unlikely a positive case will ever be proved.

Philosophies from Aquinas, Augustine, and Irenaeus and other theologians Essay Example for Free

Philosophies from Aquinas, Augustine, and Irenaeus and other theologians Essay The study of religion and philosophy is infinitely confronted with the problem of evil and its broad association to sin. In facing this debacle, there is a tendency for religion to deny the existence of evil and clearly explicate that it is a mere event in the undeveloped minds of people. Religion may also uphold that there is a competent rivalry between evil and good as evil can be considered as a rival authority, containing power equal to the divine good. It can also be derived that evil is the imperfect cooperation in the good explained under the presence of a deity deemed as omnibenevolent and omniscient. Some response concerning the evil include that debates which inculcate that the true free will cannot be established without the possibility of evil. This idea can be translated to the notion that humans are not able to understand and comprehend God, that spiritual growth and development necessisitates suffering and that evil is the impact of effect of the fallen and disrupted world. Many disciplines have attempted to provide a concrete definition of evil and sin and the proposed assumptions on the connection of evil to sin have encountered denials coming from other scholars. In this paper, multiple philosophies and valuable insights concerning the association of evil to sin will be explored. The teachings of Thomas Aquinas, Irenaeus and Augustine and of others will be discussed in order to define evil and sin, describe the relationshipof evil to sin, and to explicate the difference and the causality of sin and evil in the contemporary world. This papers central focus is on the inquiry: Every evil is sin, but is every sin evil? The Teachings of Thomas Aquinas on Evil and Sin The concept of evil by Thomas Aquinas and his entire miscellany of philosophy are naturally grounded upon the teachings of the St. Augustine who created a philosophical theological position on evil. Evil is an English noun that is commonly used today to describe anything that is undeniably horrendous, particularly in the aspect of human behavior. However, Thomas Aquinas says that the term evil has more inclusive sense than evil does for people. According to Aquinas, â€Å"we are dealing with evil whenever we are faced by whatever can be thought of as a case of falling short. † For Aquinas, there is no evil substance in the world and neither God nor man creates evil. In saying this Aquinas proves that the world is â€Å"created and governed by a perfectly good God who is also omnipotent and omniscient. † This teaching negates the argument of humans who say that each time some of the good stray aways from an object then it is evil. Aquinas says no this argument by declaring that no evil exists materially. Aquinas explicates that human beings are wholly good but have the tendency that some of their goodness will be removed. Aquinas strongly argues that there is a â€Å"serious sense in which it can be thought of as lacking in being. † Take for instance the thought of Adolf Hitler as wholly good. This example may raise several criticisms since Hitler has enjoyed being a household name for evil, but it is to illustrate Aquinass concept of evil caused by the removal of good. For Aquinas, Hitler is good- he has competent brain, his physique is complete, and he almost bares resemblance to God. But Hitler has some of his goodness removed when he tries to rule the world with tyranny. According to Aquinas, â€Å"evil is there only in the sense that something is missing. † Aquinas continues to say that â€Å"what is not there cannot be thought of as made to be by the source of the being of things. † In this sense, Aquinas follows Augustines thought and says that God can never be the cause of evil because evil is not an actual thing but the â€Å"absence of a good that ought to be present. † What causes people to be bad is the gap between who they are and how they should be but are not. Aquinas points rules out his concept of evil by illustrating that there will be no badness unless there goodness yet there can be goodness without any badness. In the aspect of sin, Aquinas writes that it is not the disobedience of irrational authority, but it is a violation of well-being. According to Aquinas, heologians may describe sin as an act againts God and philosophers may signify it as opposed to reason, but it is St. Augustine who aptly defines sin. Aquinas explains that it is more accurate to define sin â€Å"as being contrary to the eternal law rather contrary to human reason, especially since the eternal law includes many things beyond the scope of reason, such as matters of faith. † Even though Aquinas is an advocate of the philosophy of Augustine, he recognizes that the Augustine sometimes talks only about will in describing sin. Aquinas explains thaat the exterior act, which is the veruy substance of the sin, is evil itsefl and thus it is necessary to include exterior acts in the definition of sin. † However, Augustine and Aquinas both agree that the sin is evil because it harms and diminishes natural good. Aquinas takes into consideration the application of the natural law. According to Aquinas, â€Å"when it is said that all sins are evil but not because they are prohibited, that prohibition is understood as an act of positive law. † Aquinas emphasizes that since the natural law comes fron the eternal law and acts of positive law are derived from the natural law, then all sins are evil. It is argued by Aquinas that evil is the privation of good and an individual can identify the extent of privation by what is left after such action. In this idea, Aquinas is stressing that â€Å"what remains of good after every sin is the same, since there remains after every sin the very nature of the soul and the freedom of choice by which humans can choose good and evil. † Aquinas tells that all sins are equal and are evil. The focal point of Aquinas in saying that all sins are evil and that all sins are equal is the only main source capable of commanding humans what they ought to be. As a theologian, Aquinas gives emphasis to God as the main source the nature and eternal and divine law. Aquinas says that â€Å"since all are the same in turning away from God, all sins are equal. † For Aquinas, every sin is evil because it is a deviation from reason and law. Aquinas describes sin as having no cause because it has the nature of evil. It has been discussed earlier that evil is the removal of goodness whats is lacking in humans as a wholly good. Aquinas emphasizes that what is missing cannot be thought of as made to be by the source of the being of things. The same goes for sins. This concept makes both sin and evil as original which thrive on will that act against reason and divine moral law. Same with evil, God can never be the source of sin. Likewise evil can never be the cause of sin. In this sense, the evil of punishment serves as the sequel to sin. He compares evil of guilt to sin and declares that they have no difference. In saying that sin has a cause, Aquinas is quick to clarify that such cause is not necessarily a cause for sin can be impeded. This musing denotes that if there should be a necessary cause for sins, then people will keep on making sins since there is a cause inherent to them that makes them commit sins. Such notion echoes the perspective of Aquinas on whether sin has an internal cause. Aquinas argues that if sin has an internal cause, then man would always be sinning and since it has a cause, there will always be an effect. Aquinas also defines sin by mentioning virtue. Aquinas says, â€Å"But sin is evil because it takes away virtue. Therefore, all sins are equally evil, since every one of them equally takes away virtue. † Aquinas thinks of sins as contrary to virtues and that all virtues are equal. Therefore, Aquinas reaffirms that all sins are equal. He also come up with the idea of malice that is the equalizer of all sins. Aquinas says that â€Å"sin has malice in relation to turning away from God. † This feature in relation to the deviation from God states that circumstances tag the malice of sins as being more serious. Aquinas adds that â€Å" if circumstances should themselves have malice, they constitute species of sin and if they should not in themselves have any malice, there is no reason why they should make the sins more serious. † On the on the hand, the diversity in sins that other arguments are pointing to is a mere presentation of morally indifferent genus. Overall, Aquinas writes that all sins are evil in a sense that they both result in being unnatural, the failure of the natural rule that man ought to observe and obey. Evil and Sin According To Augustine Many of St. Augustines teachings on evil substantiate Aquinas concept. They both believe that the immutable God created only good things and He alone is the source of all being. Augustine negates all forms of theological and metaphysical dualism and puts great emphasis on God who is wholly good. According to Augustine, there is no dualism existing in the problem of evil. The thought of evil as not a being, a thing, or substance or entity liberates him from the Manichaean dualism,the belief that there exists two powerful beings, the good and evil. He realizes that all the God created are metaphysically and ontologically good in their being. He proposes that if evil were a being, a thing or an entity, then the problem fo evil will not be solved because it has a source. If the evil comes from God, then God is not all good and if it does not come from God, then He is not the powerful creator of all things. Augustine says that God is a spiritual and not a corporeal being and he â€Å"rejects Manichaeisms materialistic dualism but embraces a different dualism between corporeal and spiritual beings, with God, angels, and human soul falling into the latter class. † Upon rejecting the Manicheism and its simple concept on the origin of evil, Augustines obliges himself to establish an alternative solution to the origins of evil and starts to proclaim that evil represents a free deviation from God and is not a positive entity in its own right. All of the works of the immutable Creator of men are revelations of Gods nature and therefore, all of His works are of wholly good. Both Augustine and Aquinas believe that evil does not come from God. In his struggle concerning the confusion over evil, Augustine further says that the evil is not something that is completely real biut only fragment that is dependent on that which is absolutely real. According to Augustine, evil is not a thing or substance but he is aware of its existence and that it can be divided into three kinds. Metaphysical evil is the lack of mans perfection not because of his given nature but because they all fall short of complete perfection that only God can obtain. This is not actually considered evil. The second kind is the physical evil that is the privation of a certain perfection because of nature. This kind is being justified by Augustine together with the other theologians as under the jurisdiction of the general order of nature. The third kind if the moral evil, the only real evil. It is a sin or an act opposed to the will of God. The source of the moral evil is the faculty of free will in which man is able to turn away from the right order and deviate himself from the will of God. Augustine says, â€Å"sin is so voluntary that there is no sin unless it is voluntary. † He implies that there needs to be an act of moral will in any sin or the consent to turn away from God and to His will. Augustine emphasizes that moral evil is truly a sin for there is a consent. Sin settles itself in the free will, option, intention, and the motion of the soul, which instigates a wrong order into the world. Evil is â€Å"nothing but a privation of good until at last a thing ceases altogether to be. † An evil will is a kind of will that deviates away from God, the creator. Moreover, Augustine says that it is a disordered love and will, the wrong conformity to Gods will. The writings of Augustine on sin are associated with his Christian definition of evil. Augustine defines sin as the movement or the deviation of will endowed to humans away from God. He furthers his discussion of sin by stating that God can never be the author of sin just as He can never be the source of evil. Such movement of the human will away from the God the Creator is also referred by Augustine as the misdirection. According to him, as there is a misdirection on evil will, there is also a misdirection in the aspect of sin. Augustine explains that â€Å"sin is therefore an error or untruth and based upon the misconception of what is good for us. † Augustine says that when people choose to sin, they must have an intention of obtaining goodness or getting rid of something bad. He suggests that sin is more than an intellectucal error, it is the â€Å"misdirection of the will. † Augustines musing on sin as the misdirection of human will is demonstrated in mans pursuit of happiness or pride. Augustine notes that pride is the â€Å"an appetite for inordinate exaltation,it when the soul cuts itself from the Source to which it should keep close and somehow makes itself and becomes an end to itself. † Augustine continues that inordinate exaltation takes place when the â€Å"soul is inordinately pleased with itself, and such self-pleasing occurs when the soul falls away away from the unchangeable Good which ought to please the sould far more than the soul can please itself. † He also validates his definition of sin by saying that what the people do for the sake of goodness ends in something negative or bad , and what people do in making things good ends in just making things worse. Augustine explains this paradox by writing that â€Å"except that the happiness of man can come not from himself but only from God, and that to live according to oneself is to sin is to lose God. † This paradox explicates that sin is the possibility of man to focus on himself rather than on the all-knowing God. It is therefore suggested that, based upon the writings of Augustine, not all sins are considered evil due to the categorization of evil involving nature. Irenaeus On Evil and Sin Little is known about Irenaeus and his works are mostly generated fromScriptures and the biblical domain. The understanding of sin found in the works of Irenaeus of Lyons has some contradictions when compared to the dominant Christian perspective influenced by Augustine in the fifth century. Irenaeus of Lyons interprets Genesis as the disobedience of man with Adam acting like an impulsive child. Irenaeus thinks of sin as pains and errors which grow. He says that there is no such a things as original sin or guilt that man inherited from his forefather, Adam. It is seen that he has a different view of the mans fall compared to the teachings of later writers particularly Augustine. This idea posits that Irenaeus thinks of of the fall of Adam and Eve is not a rebellion against God the Creator but is a concrete illlustration of the failure of man to rise to greater heights and that humanity does not lose its original perfection. His view concerning the fall of the humanitys forefatther raises many questions as it does not seems to be based on Scripture but it is derived solely from his rational interpretation. He further suggests that the without loss of life and the presence of evils, humanity will not repent. Unlike, Aquinas and Augustine, Irenaeus imparts that evil comes from God. In this idea, it is clearly manifested that Irenaeus upholds that the appearance of evil is of righteous purpose. According to him, the elements which appear evil, like death are planned by God. He says, â€Å"it is for this reason therefore that Paul calls Adam himself the pattern of the one to come because the Word, the artisan of the universe, had sketched out in advance, in order to prepare the ground for himself, the future plan of the human race in its relation to to the Son of God, with God first of all establishing natural man order, quite obviously, that he might be saved by spiritual man. † In the said notion, Iranaeus outlines two distinct phases. Iraneaus writes that the â€Å"creation of humanity comes first, secondly comes its perfection through the incarnation of the Son, Christ Jesus, who transmits the Spirit of the whole human race. † It is evident that the advent of Christ is the sole purpose behind the creation of Adam. It is written that Irenaeus â€Å"does not identify evil with sin. † It is because he acknowledges the two types of evil. The first type is the physical evil that Irenaeus refers to as â€Å"arising from the nature of the creature for its is due to the opposition of contrary forces or to the sequences of events that obey natural laws: what seems to be an evil in the short run is a good on the cosmic. † According to Irenaeus, the second type of evil is the moral evil that he considers as sin. He declares that this type of evil is sin because it arises from the â€Å"jealousy of Satan and or certain angels who lured Adam into transgression. † Influenced by the writings of Johannine, Irenaeus defines sin as the â€Å"condition of human existence rather than a collection of individual actions. † According to Irenaeus of Lyon, moral evil is to be considered as a sin because it reflects Gods original design that is putting man into the test. This type of evil is generally accounted for mans free will and his ability to discern right from wrong. Irenaeus says that â€Å"God had foreseen the angels sin as well as that of man, including the consequences, and he had sanctioned it. † Iraneaus places sin in history and writes that the fall of man is the gradual spread of evil because of the inevitability of personal sin, not as a particular shift in the human nature. Moreover, Irenaeus has made a comparison between the natural person and the perfection of the person to describe sin. According to him,body and soul constitute a natural person while the perfect human being is made up of body, soul and spirit. The inclusion of Gods spirit is the essence of Irenaeus idea of the redemption. People have been redemeed and have been saved so that they may flourish into what God wants them to be. For Iranaeus, not all sins can be considered as evil as man is not accountable for some existing evils such as those coming from the natural disasters known as natural evils. The only evil that can be deemed as sin are the moral evils caused by the selfishness of humanity. Sin and Evil According to Other Theologians Lactantius is one of the Christian thinkers to respond to the problem of evil and sin referring solely to Gods laws. According to Lactantius, the â€Å"chief good of the humanity is not to be found in the theories of the philosophers, for these have to do things common to animals as well as humans or things not available to all humans. † He refers to the one and true God as the chief good and the things which meant to satisfy the body that perishes as not good at all. For him, pleasure, power and wealth are not good and anything and the disobedience of Gods laws are evil and sin. Reinhold Niebuhr belongs to the category of formative Christian moral theorists. He says that sin is â€Å"inevitable but not necessary. † He furthers his explannation of sin by stating that the â€Å"temptation to sin lies in the human situation itself. † Niebuhr stresses that the will and freedom endowed to man is the basis of his creativity and it is also his temptation. While Irenaeus declares that people need evil to spiritual grow, Niebuhr upholds his realist theory that people do not need sin and no perfection can completely liberate human beings from the reality of sin. Walter Rauschenbusch is included into the group of thinkers who deal with the importance of sin in salvation. According to him, â€Å"when we undertook to define the nature of sin, we accepted the old definition, that sin is selfishness and rebellion against God , but we insisted on putting humanity into the picture. † He further explains that the description of sin as selfishness will be accepted for as long as the humanity is perceived as a great solidarity with God thriving on it. He emphasizes that if sin is selfishness, then â€Å"mans selfishness consisted in a selfish attitude, in which he was at the centre of the universe, and God and all his fellowmen were means to serve his pleasures, increase his wealth and set off his egotisms. † He also rescue the dosctrine of the origin of sin from literal interpretations by recognizing the active sources of sin in the later generations and in the contemporary period. He was criticized upon recognizing that both goodness and sinfulness can be determined by social environment. Rauschenbusch explains that what can be evil is dictated by the society and the same goes for sin. He says that the good maybe forced to do bad while the bad maybe forced to do good as dictated by the society. Conclusion In the tradition of religion and theology, the definition of sin is related to the problem on evil. The question addresed in this paper is whether sin leads to evil or evil leads to sin. The definition of evil and sin according to several theologians were explored in this paper in order to understand the relationship between evil and sin. Based from the literatures studied, it is said that the relationship between evil and sin can be associated with reconciliation, salvation, the fall of Adam and the society itself, and morality. It is clearly manifested that the connection between sin and evil can be interchangeable such that evil can lead to sin and sin can lead to evil. The interchangeable connection is due to the observed judgement that evil and sin have the same feature as the deviation from what man ought to be. In this sense, all evil can be sin but not all sins are considered evil due to the fact that sin comprises only the moral and spiritual side of the humanity. The inquiry on whether every sin is evil is answered on the definition of evil in which various theologians categorize into various theories. This paper has observed that every theologian has his or her own conception on evil and sin and it is evident that their concepts have been derived from other theologians who took insights also from other thinkers. This is to say that evil and sin can be both the same in a sense that they both have the same characteristics constructed by thinkers who draw insights from their influences. BIBLIOGRAPHY Aquinas, Thomas. â€Å"The Subject and Approach of the De Malo,† in On Evil, eds. Richard J. Regan and Brian Davies. New York: Oxford University Press, 2003. Aquinas, Thomas, Summa Theologiae: Volume 25: Sin. New York: Cambridge University Press, 2006. Lacoste, Jean-Yves, ed. Encyclopedia of Christian Theology, Vol 1. New York: Routledge, 2005. Mann,William E. â€Å"Augustine on Evil and Original Sin,† in The Cambridge Companion to Augustine, eds. Eleonore Stump and Norman Kretzmann. Cambridge: Cambridge University Press, 2001. Wogaman, J. Philip. Christian Ethics: A Historical Introduction. Kentucky: Westminster/John knox Press, 1993.

Theories of Sociology :: Sociology Essays

There are many theories in sociology to get the better understanding of a society. Many things impact an individual’s behaviour, lifestyles, relationship and much more. Technology is one of the many things that affect the people. Internet is used worldwide and we can use sociology to determine what importance and place it holds in the society. To understand this invention and implication the society better, this paper will cover upon the three well-known theories which are’ Conflict, functionalism, and symbolic internationalism theories. There three theories look at the internet from different view point such as from a micro level and macro level. Functionalism focuses on the society as a whole, where as conflict theory focuses on group within that society, and symbol interactional focuses on individuals in the group and society. Thus, the view point changes depending on the population and the perspective. One of the important perspectives is a structural-functionalism. This approach focuses on â€Å"various components of society without prioritizing or assessing their importance to the social system as a whole; in effect all elements of a society are weighed equally† (Naiman, 2004; pp.18). In terms of internet, a functionalist would see the internet as a resource that brings efficiency in the lives of individuals for the reason that it is convenient. It also allows people to interact with one another around the world. A functionalist would ask questions regarding the function of the internet in the society would be: how does the internet help people access their provisions faster? How does it help people acquire knowledge and how can services be accessible to the demanding population? Thus, it mainly considers the benefits for all instead of few individuals. The internet is more efficiently used now a days because it saves one’s time. An individual can spend few minutes online, booking a flight ticket instead of going to the travel agency in-person or calling the customer services and going through a long hectic procedure. As the technology gets advance, it plays even greater role in shaping the lives of the individuals. Also, some people may wish to visit the bureaucracies. However, others may not have the time to visit the offices due to family responsibilities or for other reasons. Functionalist theorist would see a vast benefit when it comes to administrative related online services. It eliminates the waiting list and makes life easier for the citizens and it will take less space in the bureaucracies.

Modifying The Conduct Of Professional Military Education Education Essay

Education, in the military profession, is the procedure of culturing a individual to the hereafter needs of the administration. This procedure of preparing an person to accommodate the wide-ranging demands of the system is of paramount importance. Airmen of tomorrow will hold to set about operations which are non merely web centric but besides knowledge centric. As the universe changes at an unprecedented and speed uping rate, the constructs of war, peace, and struggle merge with each other. Human-centered aid, war against panic, insurgences, and rebellions now occupy the Centre phase for most armed forces. Success in any operation will come from sound preparation and quality instruction. Professional Military Education ( PME ) will play an of import function in guaranting that the IAF theodolites onto a more effectual acquisition environment. Effective PME will play a important function in the effectivity of any contending force in the hereafter. There is frequently confusion in the form in which military instruction should be conducted and the mode in which the officers have to be groomed. IAF requires officers who are educated so that they are able to happen solutions to the battalion of unexpected challenges that are bound to face them in the class of their callings. 2. Education is a uninterrupted procedure. If any organisation does non acknowledge the importance of instruction, it certainly is non germinating. It is a ‘must vision ‘ for an organisation like Indian Air Force to hold its officer cell strong in professional cognition, flexible and turning in idea and imaginativeness. Amidst turning national security challenges, Professional Military Education ( PME ) has to germinate to provide for the demands of a more complex and engineering intensive environment as we head towards our vision of tomorrow. In fact continued and comprehensive instruction plan is indispensable to develop rational abilities amongst officers to set about diverse missions in an intricate security scenario.Purposenecessities of instruction procedure and to give matter-of-fact and practical suggestions to modify the behavior of professional military instruction for officers in the IAF, providing to the complexnesss of future wars.Understanding EducationDiffe rence between preparation and Education4. Training and instruction are two different procedures despite being associated with the similar demands of acquisition. The construct of preparation is usually designed to get specific accomplishments. These acquired accomplishments make a individual more employable and specialized in any profession. Therefore preparation is more specific, more focussed on a peculiar undertaking and is for a limited period of clip. Education on other manus is more wide based and is related to geting cognition and heightening mind. It is a procedure of complete mental and moral development. The methodological analysis of preparation is through specialised classs while instruction is a uninterrupted womb-to-tomb procedure. Another glowering difference concerns the limited range of originative thought and normative methods used in preparation. In the preparation procedure a individual is introduced to right methods go forthing small range for original originati ve thought. Education, in contrast focal points on making independent minds. Military instruction focuses on the art of war and on developing penetrations on how to contend the wars cleverly. It enables the forces to comprehend future menaces, engage in originative ways to decide struggle, select the right tools and methods, and achieve the coveted consequence. 6. In a complex and fast changing universe, there is demand for a comprehensive, broad ranging and all inclusive educational frame work embracing an academic course of study which trains for the certainty and yet is diverse plenty to be able to educate for uncertainness.Need for a alteration in Education Pattern7. Rapid progresss in engineering and easy handiness of information dictate a serious reconsideration into the mode in which military instruction is conducted. Technology has revolutionized modern war combat. Basically what it means is easy entree to knowledge and in general an addition in cognition. In the yearss to come the full art of war combat will acquire engineering driven at an even faster rate thereby increasing the necessity to educate and intellectually equip officers to maintain gait with this alteration. In simple footings, officers will hold to possess necessary rational accomplishments to manage machine-controlled systems and work the overplus of information in the battleground. In any instance newer capablenesss would intend newer functions which will necessitate specialised accomplishments and above all a mentality to alter. A good structured educational form will play a important function in fixing officers to understand and confront these challenges. Military officers will necessitate particular accomplishments to believe, understand and show the effects of modern engineering.Importance of Critical thought8. The profession of weaponries nowadayss legion occasions where officers are confronted with diverse and complex jobs. Teaching good thought solutions may assist officers get the hang some of these jobs. However, the cardinal prevarications in critical thought which provides the tools for happening specific solutions for a battalion of unfamiliar jobs. Critical thought pertains to the ability to measure information and mental idea processes in a structured mode. The implicit in rule is to be able to buttockss and understand informati on more comprehensively. In short it is all about doing the right judgement. PME in the IAF needs to advance critical thought so as to enable officers to get at rational and good reasoned determinations. A critical mind should be able to sift through overplus of informational inputs available to him and descry precisely what is unlogical and irrational. It is indispensable to provide for the extremely intricate and unstable nature of environment that the officers face presents. PME within the IAF needs to make full up nothingnesss created by deficiency of formalistic instruction for developing critical thought. To get down with there is demand for a vision in this field. Appropriate academic course of study and specialised classs can thenceforth be defined. The academic plan designed should advance believing accomplishments which remain unschooled in other educational classs. Thereafter, IAF can travel on to develop non traditional methods to absorb critical thought accomplishments in its officer cell. Web-based collaborative acquisition environments can be efficaciously utilised to educate officers utilizing simulations of modern-day military jobs.PROPOSED MEASURES FOR INTELLECTUAL DEVELOPMENT9. One of the most ambitious undertakings of a well planned PME plan is to bring forth inventive, advanced, adaptative and critical thought officers. The cardinal prevarications in following an educational plan which targets rational development and in a go oning mode. Some methods of guaranting overall rational growing are as given below: – Comprehensive Educational Framework. PME templet has to be complete in all respects in order to provide for comprehensive rational growing. This would connote taking and aiming the right topics at an early phase of an officer ‘s service calling. Most bing PME plans in IAF trade with basic professional and service specific topics and deficiency range for rational growing. In current scenario IAF is likely to be involved in a broad spectrum of operations including transnational operations necessitating all officers to hold an in deepness apprehension of complex topics such as Strategy, International Relations, Geopolitics, International jurisprudence, Economics and Military operations. These topics need to be introduced and taught from an early phase of an officer ‘s service calling so as to develop appropriate consciousness and consciousness right from the beginning. PME plans soon target limited transverse subdivision of officers and are non crossing the full service call ing. In-service classs in the IAF have been classified as mandatary, desirable and need based classs. While basic classs such as BASCO, ISCO, APKC and the Air staff Course are compulsory for all officers, there are other classs such as LDMC, HDMC, Higher Command, NDC etc which are merely desirable or need based and non done by all officers. Education is an indispensable tool for officers at all degrees of senior status. IAF may even believe of outsourcing military instruction and promote officers to avail survey leave and take up educational classs in civilian universities or with professional institutes abroad. Any signifier of pursuit for higher instruction should non be a hinderance to career promotion, but alternatively should be complementary and compulsory to career patterned advance. Most in service classs have now been made assessable and contribute to career patterned advance at least at the junior degree. Assessment in classs will merely give scholarly end product and may non needfully give out the existent rational degree of an officer. In any instance appraisal should ne'er be ultimate the purpose of any signifier of instruction, alternatively it should be rational development. PME should be compulsory for all degrees of officers, merely the demands at each phase should change. Some idea besides needs to be given to the sort of module we employ for carry oning PME. Often majority of our instructors come from within the service and may non possess needed educational experience or professional instruction accomplishments. Specialized topics would necessitate experient instructors who are non merely qualified but besides competent. Adapting Educational Programs to accommodate contemporary conditions. Security environment in the universe and within the state has changed over the old ages. Indian military readiness has changed from being simply Pak centric to modern twenty-four hours concerns like internal security, procuring our maritime boundary lines, international terrorist act, cyber warfare and atomic issues. PME besides needs to alter as per the demands placed on the present twenty-four hours IAF officer. Academic plans need to be diverse plenty to fix IAF officers non merely for tactical operations but besides strategic and operational degrees of operations. In simple footings, PME must fit IAF officers with suited academic abilities to cover with current jobs and besides remain relevant to the drawn-out functions. Adequate clip for Assimilation. All instruction plans have to be focussed to guarantee maximal assimilation, cognition augmentation and enhanced apprehension. Towards this IAF must follow educational waies with good spaced out academic course of study. Education is a womb-to-tomb procedure and can non be enforced. Alternatively there is a demand to foster and inflame quest for cognition. Assorted larning methods could be adopted changing from distance larning to net enabled acquisition bundles. Scenario based practical acquisition methods and determination simulations can be used to polish larning experience. Besides the content, equal thought demands to be given to manner in which the instruction will be conducted. Often unequal clip and deficiency of focal point by the administration towards educational plans tend to set off a scholar. The current distance larning plan implemented for junior officers in the IAF is an illustration. In short IAF has to hold a vision Any sort of PME p lan in IAF must guarantee dedicated learning clip for officers. Education for life. The service life of an officer can be loosely categorized into different phases of development get downing from the clip he joins the service to the clip of retirement. At each phase, the type of mental training and instruction demands are specific yet interlinked. A comprehensive educational plan with ample deepness and comprehensiveness has to be defined for the full service calling of every officer. Learning has to be broad ranging, wide based and uninterrupted. The different phases are: – Early Stage ( till 6 old ages of service ) . This is the most important phase of mental training and doubtless the most of import period in an officer ‘s calling. This phase lays the foundation for all subsequent rational growing. Education during this period should chiefly be concerned with professional topics with an purpose of fixing a sound professional. Apart from this educational plans could besides be utilized to transfuse a strong sense of pride in state and service, chumminess and espirit-de-corps. Complex topics such as leading, direction, moralss, scheme and international dealingss need to be introduced at this phase in order to foster a thought head at a ulterior phase. Availability of clip is frequently a restraint to effectual execution of any sort of educational plan at this phase and at that place has to be a balance between professional preparation activities and educational plans supplying rational growing. Phase II. This phase is from 7 to 18 old ages of service. The officer in this phase must be educated in nucleus competences of professional activities. Career patterned advance usually is the focal point during this phase. The officer must be encouraged to hone his planning and executive accomplishments. The traits that need to be watched are over assurance and misplaced sense of accomplishment. Educational focal point should now get down switching from service-specific proficiencies to joint operations. Once once more accent has to be on developing a thought head. Self acquisition has to be encouraged and rewarded. Phase III. Stage III is from above 18 old ages of service. During this phase an officer gets a opportunity to command an independent unit and goes on to work in assorted bid and staff assignments. Good cognition of executive maps, effectual fiscal, stuff and human resource direction are some important demands at this phase. In add-on educational plans have to transform selected officers into strategic analysts and advisers. Military officers in this class have to maturate as military leaders with a balanced, unfastened and academically complete head. Quest for instruction has to be promoted by promoting doctorial and Masterss ‘ grades in strategy-related subjects at reputed civilian universities both within the state and abroad. Encouraging Critical idea. Problem work outing and critical thought accomplishments have become necessary for all classs of officers and non merely for senior Air Force officers. Critical thought is an country that needs to be consciously addressed in PME plans. Blending Education with experience. In this context, the demand for instruction and experience are critical to the officers in the hereafter environment. The modern defense mechanism scheme demands us to keep a combat capableness across the full spectrum of struggle and we must make so in an environment of decreased resources being available for purchase of new high engineering equipment. As good, the choice of what high engineering equipment is to be purchased will go more of import as we try and maintain interoperability with Alliess in the hereafter. Finally, there is a demand to put a new construct of what it means to be a thought soldier. What is needed is non soldiers advised by bookmans – but instead soldier-scholars, or soldier-linguists, or soldier-social scientists, at appropriate degrees.DecisionEducation of officers within the IAF is a critical and cardinal investing. Any educational plan is borne out of experience over the old ages. It is an germinating procedure, which changes from clip to clip, maintaining the complexnesss demands of the administration in head. The quality of PME within the service will specify The human resource policy on manpower use Sept 2010 ( Jaspreet Singh ) Wg cdr